Rnaiso plus total rna extraction reagent

Total RNA was extracted from the longissimus dorsi and gastrocnemius samples of pigs with RNAiso Plus Total RNA extraction reagent (Takara Bio, Shiga, Japan), according to the instructions. An amount of 2 μL of total RNA was taken, and primescript^® RT Kit (Takara bio, Shiga, Japan) was used to synthesize complementary DNA (cDNA). PCR reactions were performed using the Roche SYBR Green PCR kit (Roche Hercules, CA, USA) (the PCR reaction mixture volume was 20 μL), according to the manufacturer’s instructions. The cDNA of muscle samples was analyzed by the ABI 7300 real-time PCR system (SDS, foster, CA, USA). Primer sequences are listed in Supplementary Table S2. The relative RNA expression of the target genes was calculated by formula 2^−ΔΔCt [31 (link)].

Quantitative PCR (qPCR) was used to evaluate the expression of osteoclastic genes during RANKL-induced OC formation. M-CSF-dependent BMMs were seeded into a 6-well plate and stimulated with RANKL in the absence or presence of 50 mM ethanol for 1, 3, 5, or 7 days. Total RNA was isolated from each well by using the RNAiso Plus total RNA extraction reagent (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol. First-strand cDNA was synthesized using the PrimeScript RT cDNA synthesis kit (Takara Bio) and 1 μg of the extracted RNA template. qPCR was then carried out using SYBR Green real-time PCR master mix (Takara Bio) and the following cycling parameters: 40 cycles at 94°C for 20 s, 60°C for 20 s, and 72°C for 30 s. The results were normalized to the expression levels of β-actin as an internal housekeeping gene. The primer sets used are listed in Table 1.

The CPR cDNA sequence was obtained by searching the N. lugens transcriptome database in the Sequence Read Archive database (http://www.ncbi.nlm.nih.gov/sra, accessed date: 7 January 2019) (SRA accession number SRX023419) [28 (link)]. Total RNAs were extracted from the whole bodies of the various developmental stages using RNAiso Plus Total RNA extraction reagent (Takara, Dalian, China). First-strand cDNA was synthesized using HiScript^® II Q RT SuperMix for qPCR with gDNA wiper Mix (Vazyme Biotech, Nanjing, China). A pair of primers (sense: 5′-ATGGAGGTGGAGGCTGACTTAG-3′; antisense: 5′-TCAACTCCATACGTCGGCCG-3′) were designed to amplify the complete open reading frame (ORF) of the CPR gene. PCR was performed using 2 × Phanta^® Max Master Mix (Vazyme Biotech, Nanjing, China). The PCR product was cloned into the pMD19-T vector (Takara, Dalian, China) and sequenced by Sanger sequencing (Tsingke Biotech, Beijing, China).

Total RNA was extracted from EC patients’ tumors and adjacent tissues obtained from Hebei General Hospital using RNAiso Plus total RNA extraction reagent (Takara, Japan). cDNA was synthesized using a PrimeScript RT reagent Kit with gDNA Eraser (Takara, Japan). The reaction conditions were as follows: 37 °C for 15 min, 85 °C for 5 s and 4 °C for termination. The real-time PCR was performed on the Bio-Rad CFX 96 Real-time PCR system (BIO-RAD, USA) using SYBR Premix Ex Taq Real-Time PCR Kit (Takara, Japan) and specific primers (Z94721.1, Forward: CCAAAACAACACTGCCCGAG, Reverse: GCTGACCGATTGACCAGACA; AL035461.2, Forward: AGGTGACTCGCTGCATCATT, Reverse: CCGTGTGGGACACTTACTCG; AC051619.4, Forward: GACACTTCTGGTTGGGGCAT, Reverse: CAACTCTCATGTGCAGGGCA). The reaction conditions were one cycle of initial denaturation at 95 °C for 3 min, followed by 35 cycles of 95 °C for 30 s, 60 °C for 30 s. The 2−ΔΔCq method was used to calculate gene expression. The differences were tested by Two-Sample t-Test.

Total RNA was extracted from cells and tissues using RNAiso Plus total RNA extraction reagent (Takara Bio, Inc., Shiga, Japan) and complementary DNA was synthesized using a qRT-PCR kit (Takara) according to the manufacturer’s recommendations, using the following primer sequences: human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) forward: 5′-CCA TGG AGA AGG CTG GGG-3′, reverse: 5′-CAA AGT TGT CAT GGA TGA CC-3′; human PSGL1 forward: 5′-TCC TCC TGT TGC TGA TCC TAC TG-3′, reverse: 5′-TAC TCA TAT TCG GTG GCC TGT CT-3′; mice GAPDH forward: 5′-TGG CCT TCC GTG TTC CTA C-3′, reverse: 5′-GAG TTG CTG TTG AAG TCG CA-3′; mice IL-6 forward: 5′-TAG TCC TTC CTA CCC CAA TTT CC-3′, reverse: 5′-TTG GTC CTT AGC CAC TCC TTC-3′; mice TNF-α forward: 5′-TAG CCC ACG TCG TAG CAA AC-3′, reverse: 5′-GCA GCC TTG TCC CTT GAA GA-3′; mice IFN-β forward: 5′-CTC CAC AGC CCT CTC-3′, reverse: 5′-CAT CTT CTC CGT CAT CTC CAT AG-3′. Relative changes in mRNA expression were normalized to that of GAPDH using the 2^−ΔΔCt method.

Total RNA was extracted from the proximal femur using RNAiso Plus (Total RNA Extraction Reagent, TaKaRa Bio Inc, Tokyo, Japan) in accordance with the manufacturer’s protocol. Total RNA of each group was extracted at optimal effect of induction. Approximately 1000ng of total RNA was reverse transcribed using the Prime Script1TM RT Reagent Kit with gDNA Erase (TaKaRa Bio Inc, Tokyo, Japan). qPCR was performed in triplicate in a 20μl volume, using SYBR1Premix Ex TaqTM II (TaKaRa Bio Inc, Tokyo, Japan) and the CFX96 Touch TM Real-Time PCR Detection System (Bio-Rad, CA, USA) according to the manufacturers’ instructions. Gene expression was determined relative to the housekeeping gene GAPDH using the 2^–ΔΔCt method [39 (link)]. Specific primers were list as follows within the Sangon Biotech (Shanghai, China) designed (Table 1).

Whole blood was collected from Chinese woodchucks and total DNA were isolated using EZNA Blood DNA kit (Omega Biotek, Doraville, GA). RNA was isolated from the whole blood by using RNAiso plus total RNA extraction reagent according to the manufacturer’s instructions (TaKaRa, Dalian, China).