ChIP assay was performed using Chromatin IP kit (Cell Signaling Technology, Beverly, MA, USA) according to the manufacturer's protocol. Briefly, 107 adherent PC3 cells were crosslinked with formaldehyde, collected and digested to produce chromatin fragments. KLF4 antibodies (Santa Cruz, Dallas, TX, USA) and normal goat IgG control (Cell Signaling Technology) were used for ChIP respectively. ChIP DNA was purified and analyzed by qPCR and sequencing. KLF4 relative enrichment was calculated by the formula provided in the protocol. ChIP primers are available in the Supplementary List 5 .
Klf4 antibody
Manufactured by Santa Cruz Biotechnology
Sourced in United States
KLF4 antibodies are designed for the detection of Kruppel-like factor 4 (KLF4) protein. KLF4 is a transcription factor that plays a role in regulating cellular processes such as proliferation, differentiation, and development. These antibodies can be used in various applications, including Western blotting, immunohistochemistry, and immunofluorescence, to study the expression and localization of KLF4 in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
6 protocols using klf4 antibody
1
Chromatin Immunoprecipitation (ChIP) Assay
2
ChIP-qPCR Analyses of KLF4 and HIF1α
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For in vitro ChIP assays, mouse aortic SMCs treated with 10 μg/ml POVPC or DMSO-vehicle for 3, 6 or 12 hours were fixed with 1% paraformaldehyde for 10 min at room temperature. For in vivo ChIP assays, mouse aortas (arch, thoracic and abdominal regions) were quickly dissected from surrounding tissue, washed in ice-cold PBS to remove blood and debris, snap frozen in liquid nitrogen, and stored at −80 ° C. Tissues were later ground with a mortal and pestle with liquid nitrogen for cooling and transferred directly to 37 ° C 1% formaldehyde for 10 min. Cross-linking was stopped by adding 125 mM glycine for 10 min. The cross-linked chromatin was sonicated to shear chromatin into fragments of 200–600 base pairs. The sheared chromatin was immunoprecipitated with 2 μg of KLF4 antibodies (Santa-Cruz; sc-20691) or HIF1α antibodies (Abcam; ab1), or control IgG (negative control), and immune complexes were recovered with magnetic beads (Millipore). qRT-PCR was performed using SensiFASTTM SYBR NO-ROX Mix (Bioline) and primers specific for the Oct4 promoter (Supplementary Table 3 ). Results were normalized to the total Input.
3
ChIP-qPCR Analyses of KLF4 and HIF1α
4
KLF4 Binding Assay via EMSA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Electrophoretic mobility shift assay (EMSA) was performed using nuclear extracts according to the protocol of the Light Shift Chemiluminescent EMSA Kit (Pierce, Carlsbad, CA, USA). Double‐stranded DNA probes (5′‐GTGAATGTGGGGCAAGAAGGGGGGGGGAGACCTGTGGGTGTCTCT‐3′ and 5′‐AGAGACACCCACAGGTCTCCCCCCCCCTTCTTGCCCCACATTCAC‐3′) were generated. Double‐stranded mutant DNA probes: 5′‐ATATAGAGCAAGAAGGGGGGGGGAGACCTATAGATG‐3′, 5′‐CATCTATAGGTCTCCCCCCCCCTTCTTGCTCTATAT‐3′. Nucleotides were labeled using biotin 3′‐end DNA labeling (Pierce). Detection of supershift mobility was assessed by reaction of KLF4 antibody (Santa Cruz Biotechnology) with nuclear extracts for 30 min before addition of the labeled nucleotides for the EMSA.
5
KLF4 Transcriptional Regulation in Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The selected cells were harvested and processed to prepare nuclear extracts. Nuclear extract proteins (200 μg) obtained from cancer cells were incubated with 5' biotinylated double-stranded hTERT promoter probe (sense: 5' CTGCTGCGCACGTGGGAAGCC 3' and anti-sense: 5' GTCCCCGCGCTGCACCAGCC 3') and 30 μL of streptavidin-agarose beads. The mixture was placed on a rotating shaker with gentle mixing at 4°C overnight. After incubation, the tubes were centrifuged at 5000 g in a microcentrifuge for 30 s, and the supernatant was removed. The pellet was washed three times with ice-cold PBS. The pulled down mixture was resuspended in 30 μL of 4×loading buffer and heated for 5 min at 100°C. The proteins in the complex were dissociated and analyzed using Western blot analysis. Next, 20 μL of the KLF4 antibody (Santa Cruz Biotech, sc-20691) was used in the test, and a normal rabbit-IgG (1 μL/mL) was used as the control.
6
KLF4 and hTERT Immunofluorescence Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
H322/mock, H322/c2 and H322/c5 cells were cultured in 1640 medium and plated in 6-well plates at a density of 1 × 105 cells per well; then, 2–4 glass coverslips were placed in each of the wells. The plates were incubated for 24 to 48 hours until reaching 30–40% confluence prior to fixation; they were then fixed with 4% paraformaldehyde for 10 min and permeabilized with 0.1% Triton X-100 in PBS. The slides were washed three times with PBS and blocked with 5% BSA in PBS for 30 min at room temperature. The cells were incubated with the KLF4 antibody (1:100; Santa Cruz Biotechnology, sc-20691) or hTERT antibody (1:100; Santa Cruz Biotechnology; sc-68720) overnight at 4°C, which was followed by incubation with a fluorescein isothiocyanate (FITC)-conjugated anti-rabbit secondary antibody (1:100; Thermo Scientific) for 30 min in the dark. Nuclei were counterstained with DAPI for 15 min and then analyzed using a fluorescent microscope.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!