Total RNAs were extracted using the RNeasy mini kit (Qiagen GmbH, Hilden, Germany). Gene expression was analysed using RT-qPCR. Total RNAs (1 μg) were reverse transcribed for 60 min at 37 °C using Superscript II reverse transcriptase (Invitrogen, Auckland, NZ) in the presence of a random hexamer. A minus reverse transcriptase reaction was performed in parallel to ensure the absence of genomic DNA contamination. RT-qPCR was performed starting with 25 ng of cDNA and 300, 500 or 900 nM concentration of a mix of sense/antisense primers (depending on genes) in a final volume of 25 μl using the SYBR Green Universal PCR master mix (Applied Biosystems, Foster City, CA). Fluorescence was monitored and analysed in a GeneAmp 7300 detection system instrument (Applied Biosystems, Foster City, CA). Analysis of housekeeping genes HPRT and GAPDH (500 nM) was performed in parallel to normalize for gene expression. Data were analysed by the 2−ΔΔCt method and presented as fold change relative to a control sample after normalization against the expression of housekeeping genes. Here Ct corresponds to the number of cycles needed to generate a fluorescent signal above a predefined threshold. All primers used in this study have been validated for PCR efficiency and are presented in Table 2 .
Sybr green universal pcr master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom
SYBR Green Universal PCR Master Mix is a ready-to-use solution for real-time PCR amplification. It contains SYBR Green I dye, DNA polymerase, dNTPs, and necessary buffers and components to perform quantitative PCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Rneasy mini kit, by Qiagen (6 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (5 mentions)
Taqman universal master mix, by Thermo Fisher Scientific (4 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (3 mentions)
Mini protean tgxtm precast gel, by Bio-Rad (3 mentions)
Rna stat 60, by Tel-Test (2 mentions)
Taqman reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Abi prism 7000 sequence detector system, by Thermo Fisher Scientific (2 mentions)
Steponeplus, by Thermo Fisher Scientific (2 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Revertaid h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Reverse transcriptase system kit, by Thermo Fisher Scientific (2 mentions)
Taqman assay, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr machine, by Thermo Fisher Scientific (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Qiazol lysis reagent, by Qiagen (1 mentions)
36 protocols using sybr green universal pcr master mix
1
RT-qPCR Gene Expression Analysis Protocol
2
Nuclear and Cytoplasmic RNA Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Accordingly 29 , 33 (link), cells were collected, resuspended in lysis buffer (10 mM NaCl, 20 mM MgCl, 10 mM Tris-HCl, pH 7.8, 5 mM DTT, 0.5% NP-40) and kept in ice for 5 minutes. Nuclei were pelleted by centrifugation at 8000 rpm for 5 minutes at 4°C, pellets were washed and resuspended in lysis buffer. The cytoplasmic fraction was collected to a new tube and clarified by centrifugation. Nuclear and cytoplasmic fractions were subjected to protease treatment for 20 minutes at 37°C by adding an equal volume of proteinase K solution (300 mM NaCl, 0.2 M Tris-HCl, pH7.5, 25 mM EDTA, 2% SDS and 0.1 mg/ml proteinase K), and RNA was purified using the QIAzol Lysis Reagent (Qiagen, Germany). The RNA was subjected to DNase treatment; cDNA was synthesized using the QuantiTect Reverse Transcription Kit (Qiagen, Germany) according to the manufacture's protocol. Quantitative real time PCR was performed on StepOnePlus real-time PCR machine (Applied Biosystems, UK), using SYBR Green Universal PCR Master Mix (Applied Biosystems, UK). Oligonucleotides used for quantitative and semi-quantitative PCR are listed in Table S3 .
3
Quantitative Real-Time PCR Analysis of Mouse Tissue
4
Quantifying gene expression profiles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from infected or uninfected Hec-1-B monolayer cells at indicated time points using RNeasy Mini Kit (50) (Promega, France) according to the manufacturer's instructions. Two hundred nanograms of RNA were used as the template in the reverse transcription reaction. The total cDNA was obtained by reverse transcription PCR using the oligo(dT)18 primer and AMV reverse transcriptase (Biolabs, France) as described elsewhere [87 (link)]. The mRNA sequences for the target genes (IL-8, TNF-α, and cFLIP and β-actin of Homo sapiens) were obtained from the GenBank database (http://www.ncbi.nlm.nih.gov/ ). β-Actin was used as an internal control. Specific primers were designed using Primer Premier 5.0 (S2 Table ) and synthesized by Sigma Aldrich (France). The qPCR reaction was performed on an Applied Biosystems model StepOne plus in triplicate using 25 ng of cDNA and SYBR green Universal PCR Master Mix in a total volume of 25 μl. The program consisted of an initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Quantification of the targets was performed relative to uninfected sample using β-actin as internal control and the 2−ΔΔCT method [88 (link)].
5
Quantitative PCR Analysis of Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells using the RNeasy method, and cDNA synthesized using the Omniscript Reverse Transcriptase Kit (Qiagen) and oligo(dT)15 primer (IDT, Coralville, IA) according to the manufacturer’s instructions. Real-time quantitative PCR (qPCR) was performed using an ABI 7500 (Applied Biosystems, Foster City, CA) using SYBR Green Universal PCR Master Mix and No AmpErase UNG (Applied Biosystems). Primers for CCL2, CCL20, CXCL10, IL-10 and β-actin were purchased from Qiagen. The thermal cycler was set to perform an initial set-up (95°, 10 min) and 40 cycles of denaturation (95°, 15 sec) followed by annealing/extension (60°, 1 min). After determining that all primer pairs used amplified with approximately equal efficiency (data not shown), the relative amount of mRNA for the genes of interest was determined by subtracting the threshold cycle (Ct) values from the Ct value for the internal control gene β-actin (ΔCt). Data are depicted as fold difference from untreated control using the 2−ΔΔCt method.
6
Quantifying NLR mRNA Expression in Podocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine messenger RNA (mRNA) expression of three NLRs, total RNA was extracted from differentiated podocytes using Trizol. After reverse transcription of RNA, the mRNA level of each target gene was quantified on ViiATM7 Dx Real-Time PCR (Applied Biosystems, Foster City, CA, USA) using SYBR Green Universal PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. The fold change of expression levels were calculated using the comparative ΔCt method. Primers used for PCR: NOD2 forward ACCTTTGATGGCTTTGACG and reverse CACCTTGCGGGCATTCTT, NLRP3 forward TGAAGAAAGATTACCGTAAGAAGTACAGA and reverse GCGTTTGTTGAGGCTCACACT, NLRC5 forward TGGGAAGACACTCAGGCTAA and reverse ATCATCGTCCTCACAGAGGTT, beta-actin (housekeeping gene) forward ACCACACCTTCTACAATGAGC and reverse CAGCCTGGATAGCAACGTAC.
7
Quantifying TNFα Expression by Real-Time qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TNFα expression at the transcriptional level was measured by real‐time qRT‐PCR using primer sequences specific to human TNFα and human GAPDH, used as reference gene. TNFα forward: 5′CCCAGGGACCTCTCTCTAATCA, TNFα reverse: 5′AGCTGCCCCTCAGCTTGAG; GAPDH forward: 5′CCCCTTCATTGACCTCAACTAC, GAPDH reverse: 5′GATGACAAGCTTCCCGTTCTC. Total RNA was extracted with TRIZOL reagent (Ambion Life Technologies, UK). Two microgram of purified RNA was treated with DNaseI (Life technologies, UK), then heat inactivated after the addition of EDTA (final concentration 5 mM) at 65°C for 10 min to stop DNaseI activity. The cDNA was generated using GeneAmp RNA PCR core kit (Applied Biosystems, UK). qPCR was performed using SYBR green universal PCR master mix (Applied Biosystems, UK) and ABI7900 real‐time PCR instrument (Applied Biosystems, UK). Gene expression was quantified using the comparative C t ∆ C t ∆ ∆ C t 2 − ∆ ∆ CT
8
Quantitative Real-Time PCR Analysis of SCFA Effects
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microgram RNA was used for cDNA preparation with random hexamer primers using RevertAid™ H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, USA). Quantitative PCR was performed with the Applied Biosystems 7900 HT Fast Real‐Time PCR System (Applied Biosystems, Foster City, USA) using TaqMan or SYBR® Green Universal PCR Master Mix (Applied Biosystems), gene‐specific primers (3 μM each), and 5 ng cDNA. Primer and probe sequences for murine samples were used as previously described 12 ; the primers for the human HepG2 samples are listed in Supporting Information Table 1. Gene expression in the animal samples was calculated according to the ΔΔCT method using hypoxanthine guanine phosphoribosyl transferase as reference gene and expressed relative to the HF group (without SCFA) normalized to a value of 1. In the HepG2 samples, the ribosomal protein L13a (Rpl13a) was used as reference gene and gene expression was calculated relative to control medium without SCFA.
9
Relative Quantification of Lhcgr mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After identification of the specific Libyan jird cDNA sequences Lhcgr and β-actin, we designed new primers on two different exons for the quantitative real-time PCR analysis using the Primer Express software (Table 2 ). Relative levels of total Lhcgr mRNA were examined by real-time PCR using an ABI Prism 7000 Sequence Detector System and the SYBR Green Universal PCR Master Mix, according to the manufacturers’ recommendations (Applied Biosystems, Courtaboeuf France). Briefly, samples were heated for 10 min at 95 °C, followed by 40 cycles or 45 cycles of 15 s at 95 °C and then 1 min at 60°C in a total volume of 25 µl. The PCR was performed in duplicate, and a reagent blank, which was prepared using the Retro Transcriptase blank was included on each plate to detect contamination by genomic DNA. The reaction products were resolved in a 1.5% agarose gel and visualized with ethidium bromide to determine the lengths of the amplified DNA fragments. The β-actin gene was used as an endogenous control to normalize the initial RNA level. The ΔΔCt method [18 (link)] was used to estimate the relative amounts of testicular Lhcgr mRNA from each season compared with those of the internal standard (β-actin), and the values were compared.
10
Quantitative Analysis of CUL4B and p21 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of total RNA and qRT-PCR used to detect CUL4B and p21 mRNA levels was performed as previously described (25 (link), 30 (link)). In brief, total RNA from cultured cells was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Total RNA was transcribed to generate cDNA using PrimeScript RT Reagent Kit (Takara Co, Otsu, Japan) with random hexamers as primers. Real-time quantitative PCR (qPCR) was performed using the LightCycler 480 system (Roche, Mannheim, Germany). The mRNA levels were measured by a SYBR Green I assay using SYBR Green Universal PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. Each reaction was run in triplicate and in parallel. Primer sequences designed for qPCR are listed in Supplementary Table S6
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!