Log In Sign up
The largest database of trusted experimental protocols

Taq hot start dna polymerase

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in Germany, United States

Taq Hot-Start DNA polymerase is a thermostable DNA polymerase enzyme used for polymerase chain reaction (PCR) amplification of DNA. It is designed to remain inactive at lower temperatures, preventing non-specific amplification, and becomes active at higher temperatures required for DNA denaturation and primer annealing.

Automatically generated - may contain errors

Lab products found in correlation

Dntps, by Thermo Fisher Scientific (8 mentions) Maxima sybr green rox qpcr master mix kit, by Thermo Fisher Scientific (2 mentions) Ethidium bromide, by Thermo Fisher Scientific (2 mentions) Simpliamp thermal cycler, by Thermo Fisher Scientific (2 mentions) 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions) Qiaamp dna mini kit, by Qiagen (1 mentions) Ez dna methylation goldtm kit, by Zymo Research (1 mentions) Ampure xp bead, by Beckman Coulter (1 mentions) Fast taq, by Roche (1 mentions)

10 protocols using taq hot start dna polymerase

1

Quantitative PCR Analysis of MMPs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative PCR (qPCR) was performed with Maxima SYBR Green/ROX qPCR Master Mix Kit (Fermentas; St. Leon Rot, Germany) containing Maxima Hot Start Taq DNA polymerase and appropriate primer pairs. The following primer pairs were used: MMP-2 forward: TGGCAGTGCAATACCTGAAC and MMP-2 reverse: CCGTACTTGCCATCCTTCTC; MMP-3 forward: GTACCAACCTATTCCTGGTTGC and MMP-3 reverse: CCAGAGAGTTAGATTTGGTGGG; MMP-9 forward: ACCACTAAAGGTCGCTCGGATGGTT, MMP-9 reverse: AGTACTGCTTGCCCAGGAAGACGAA; MMP-13 forward: GGGCTCTGAATGGTTATGACATTC, MMP-13 reverse: AGCGCTCAGTCTCTTCACCTCTT; and GAPDH forward: CATGGCCTTCCGTGTTTCCTA and GAPDH reverse: CCTGCTTCACCACCTTCTTGAT. Relative mRNA expression was calculated in relation to mRNA levels of the housekeeping gene, GAPDH, according to 2-ΔΔCT method [39 (link)].
Lang G.P., Ndongson-Dongmo B., Lajqi T., Brodhun M., Han Y., Wetzker R., Frasch M.G, & Bauer R. (2020). Impact of ambient temperature on inflammation-induced encephalopathy in endotoxemic mice—role of phosphoinositide 3-kinase gamma. Journal of Neuroinflammation, 17, 292.
+ Open protocol
+ Expand
2

Quantitative PCR of Matrix Metalloproteinases

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative PCR (qPCR) was performed with Maxima SYBR Green/ ROX qPCR Master Mix Kit (Fermentas; St. Leon Rot, Germany) containing Maxima Hot Start Taq DNA polymerase and appropriate primer pairs. The following primer pairs were used: MMP-2 forward: TGGCAGTGCAATACCTGAAC and MMP-2 reverse: CCGTACTTGCCATCCTTCTC, MMP-3 forward: GTACCAACCTATTCCTGGTTGC and MMP-3 reverse: CCAGAGAGTTAGATTTGGTGGG, MMP-9 forward: ACCACTAAAGGTCGCTCGGATGGTT, MMP-9 reverse: AGTACTGCTTGCCCAGGAAGACGAA, MMP-13 forward: GGGCTCTGAATGGTTATGACATTC, MMP-13 reverse: AGCGCTCAGTCTCTTCACCTCTT, as well as GAPDH forward: CATGGCCTTCCGTGTTTCCTA and GAPDH reverse: CCTGCTTCACCACCTTCTTGAT. Relative mRNA expression was calculated in relation to mRNA levels of the housekeeping gene, GAPDH, according to 2-ΔΔCT method [23] .
Lang G., Ndongson‐Dongmo B., Lajqi T., Brodhun M., Han Y., Wetzker R., Frasch M.G., & Bauer R. (2020). Impact of Ambient Temperature on Inflammation-induced Encephalopathy in Endotoxemic Mice—Role of Phosphoinositide 3-Kinase Gamma.
+ Open protocol
+ Expand
3

SYBR Green-Based Real-Time PCR Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Real time-RT-PCR, using the SYBR ® Green method, was performed to quantify mRNA expression as previous describe (Boonjaraspinyo et al., 2012a) . PCRs were set up in 96-well real-time PCR plates. The PCR reaction mixture comprised 2 µl of 10x HotStart Taq buffer, 1 µl of 5 mM dNTP, 2.4 µl of 25 mM MgCl2, 1 µl of 5 µM primer pairs, 0.2 µl of HotStart Taq DNA polymerase (Fermentas Inc., Ontario, Canada) and 6.4 µl of distilled water to give a final volume of 20 µl. Three µl of cDNA template was added to the reaction mixture and the plate briefly spun down. The analysis was performed using an Applied Biosystems 7500 Fast Real-Time PCR System. All values were normalized relative to a standard curve and reported as a copy number change over the background of housekeeping gene (G3PDH) level.
Boonjaraspinyo S., Juasook A., Boonmars T., Aukkanimart R., Silsirivanit A., Loilome W., Sriraj P., Wu Z, & Ratanasuwan P. (2015). A Promising Serum Autoantibody Marker, Anti-Heat Shock Protein 90α, for Cholangiocarcinoma. Asian Pacific journal of cancer prevention : APJCP, 16(14).
+ Open protocol
+ Expand
4

Multiplex Methylation-Specific PCR for SEPT9

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA from tissues was extracted using a QIAamp DNA Mini Kit (Qiagen, Germany). Genomic DNA extracted from tissues was treated with sodium bisulfite using an EZ DNA Methylation-GoldTM kit (Zymo Research, USA). Multiplex methylation-specific PCR (MSP) was performed in a 25-μL volume reaction system that consisted of 50 ng sodium bisulfite-treated DNA, isometric mixture of gene primers 3 μL, 2×Master Mix 12.5 μL (Qiagen, Germany) and ddH2O. The multiplex MSP primer sequences for SEPT9 [20 (link)] and β-actin [21 ] are illustrated in Additional file 2: Table S2. We performed Hot-start PCR at an annealing temperature of 60 °C using hot-start Taq DNA polymerase (Thermo Fisher Scientific).
Jiao X., Zhang S., Jiao J., Zhang T., Qu W., Muloye G.M., Kong B., Zhang Q, & Cui B. (2019). Promoter methylation of SEPT9 as a potential biomarker for early detection of cervical cancer and its overexpression predicts radioresistance. Clinical Epigenetics, 11, 120.
+ Open protocol
+ Expand
5

Targeted sequencing of candidate SNPs

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Primers for each candidate SNP were designed as nested pairs using Primer3 (refs. 54 (link),55 (link)). External amplicons were fixed at 400–800 bp, and internal amplicons were fixed at 250–300 bp. Internal primer pairs had partial Illumina adaptor sequences added to allow the construction of barcoded Illumina libraries. Tail sequences are: left adaptor 5′-ACACTCTTTCCCTACAC GACGCTCTTCCGATCT-3′, right adaptor 5′-TCGGCATTCCTGCTGAACC GCTCTTCCGATCT-3′. PCR was performed using hot start Taq DNA polymer-ase according to the manufacturer’s instructions (Thermo Scientific). PCR1 (external primers) used a touchdown PCR approach for increased specificity. The products of PCR1 were diluted 100× and used as a template for PCR2, which added the partial Illumina adaptor tails. Candidate SNP PCRs for the same tumor were then pooled, and each tumor was barcoded with a different full-length Illumina adaptor barcode in a short PCR3 (15 cycles), so that each tumor could be decoded after sequencing. Resulting tumor-specific PCRs were pooled, cleaned up with 0.8× AmpureXP beads (Beckman Coulter), quantified and run on an Illumina MiSeq 150-bp PE run.
McCreery M.Q., Halliwill K.D., Chin D., Delrosario R., Hirst G., Vuong P., Jen K.Y., Hewinson J., Adams D.J, & Balmain A. (2015). Evolution of metastasis revealed by mutational landscapes of chemically induced skin cancers. Nature medicine, 21(12), 1514-1520.
+ Open protocol
+ Expand
6

Methylation-specific PCR for LOC134466 and TAC1

Check if the same lab product or an alternative is used in the 5 most similar protocols
It has been previously described and shown in Table 1 about what the methylation and unmethylation-sensitive primers of LOC134466 and TAC1 were used in the study. In a 25 μl reaction mixture, we amplify 1.5 μl of bisulfite-converted DNA. The reaction mixture contained 200 μM dNTPs, 10X reaction buffer, 2.5 mM MgCL2, 10 pM forward and reverse primers, as well as 1 U of FastTaq (Roche, Basel, Switzerland). Bisulfite-modified DNA was then amplified with two primer sets that differentiate methylated from unmethylated DNA. Meanwhile, we performed Hot-start PCR at an annealing temperature of 60 °C using hot-start Taq DNA polymerase (Thermo Fisher Scientific). Cases in which methylated alleles were present were repeated once again for confirmation.
Xu H., Sun Y., Ma Z., Xu X., Qin L, & Luo B. (2018). LOC134466 methylation promotes oncogenesis of endometrial carcinoma through LOC134466/hsa-miR-196a-5p/TAC1 axis. Aging (Albany NY), 10(11), 3353-3370.
+ Open protocol
+ Expand
7

16S rRNA PCR Assay for C. trachomatis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 16S rRNA PCR assays were performed in a SimpliAmp Thermal Cycler (Applied Biosystems, Thermo Fisher Scientific, Waltham, Massachusetts, USA) in a 25 μL reaction volume composed of dNTPs (Thermo Fisher Scientific, Waltham, Massachusetts, USA) (0.2mM), forward (TCCGGAGCGAGTTACGAAGA) and reverse (AATCAATGCCCGGGATTGGT) primers (0.01 mM each) (Macrogen, Seoul, South Korea), Taq Hot-Start DNA polymerase (Thermo Fisher Scientific, Waltham, Massachusetts, USA) (1.25 U), and 1 μL
C. trachomatis DNA. The thermocycling parameters were as indicated: 95°C for 3 min; 40 cycles of: 95°C for 30 s, 56°C for 30 s, 72°C for 30 s; and 72°C for 5 min and a final hold step of 4°C
19 (link)
. All PCR amplicons were resolved in 1% agarose gel and visualized on a UV Gel illuminator machine (Fison Instruments, Glasgow, United Kingdom) under ethidium bromide (Thermo Fisher Scientific, Massachusetts, USA) staining
19 (link)
.
Shiluli C., Kamath S., N. Kanoi B., Kimani R., Maina M., Waweru H., Kamita M., Ndirangu I., M. Abkallo H., Oduor B., Pamme N., Dupaty J., M. Klapperich C., Raju Lolabattu S, & Gitaka J. (2024). Multi-repeat sequences identification using genome mining techniques for developing highly sensitive molecular diagnostic assay for the detection of Chlamydia trachomatis. Open Research Africa, 7, 2.
+ Open protocol
+ Expand
8

Sensitive N. gonorrhoeae Identification Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The N. gonorrhoeae identical multi-repeat sequence (N. gonorrhoeae-IMRS) assays were carried out as previously described [18 (link)] in a reaction mixture containing dNTPs (Thermo Fisher Scientific, Massachusetts, USA) (0.2 mM), forward and reverse primers (0.01 mM for each), Taq Hot-Start DNA polymerase (Thermo Fisher Scientific, Massachusetts, USA) (1.25 U), genomic template DNA, 1 μL to a final PCR reaction of 25 μL. The cycling parameters for N. gonorrhoeae-IMRS assay were as follows: 95 °C for 3 min; 30 cycles of: 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s; and 72 °C for 5 min and a final hold of 4 °C.
All PCR products were resolved on a 1% agarose gel visualized on a UV gel illuminator system under ethidium bromide staining. Non-template controls were included in all the PCR assays and were also included in the gel electrophoresis.
Shiluli C., Kamath S., Kanoi B.N., Kimani R., Maina M., Waweru H., Kamita M., Ndirangu I., Abkallo H.M., Oduor B., Pamme N., Dupaty J., Klapperich C.M., Lolabattu S.R, & Gitaka J. (2024). Improving gonorrhoea molecular diagnostics: Genome mining-based identification of identical multi-repeat sequences (IMRS) in Neisseria gonorrhoeae. Heliyon, 10(6), e27344.
+ Open protocol
+ Expand
9

16S rRNA PCR for N. gonorrhoeae

Check if the same lab product or an alternative is used in the 5 most similar protocols
As previously described, the 16S rRNA PCR assays were carried out [19 (link)]. Briefly, a reaction mixture containing dNTPs, (Thermo Fisher Scientific, Waltham, Massachusetts, USA) (0.2 mM), forward and reverse primers (0.01 mM for each), Taq Hot-Start DNA polymerase (Thermo Fisher Scientific, Waltham, Massachusetts, USA) (1.25 U), genomic template DNA, 1 μL to a final PCR reaction of 25 μL was used. The cycling parameters for N. gonorrhoeae 16S rRNA PCR were as follows: 95 °C for 3 min; 30 cycles of: 95 °C for 30 s, 53 °C for 30 s, 72 °C for 30 s; and 72 °C for 5 min and a final hold of 4 °C. Non-template controls were included in all the PCR assays and were also included in the gel electrophoresis.
Shiluli C., Kamath S., Kanoi B.N., Kimani R., Maina M., Waweru H., Kamita M., Ndirangu I., Abkallo H.M., Oduor B., Pamme N., Dupaty J., Klapperich C.M., Lolabattu S.R, & Gitaka J. (2024). Improving gonorrhoea molecular diagnostics: Genome mining-based identification of identical multi-repeat sequences (IMRS) in Neisseria gonorrhoeae. Heliyon, 10(6), e27344.
+ Open protocol
+ Expand
10

Chlamydia trachomatis IMRS Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The
C. trachomatis IMRS assays were carried out in a SimpliAmp Thermal Cycler (Applied Biosystems, Thermo Fisher Scientific, Waltham, Massachusetts, USA) in a 25 μL reaction volume consisting of dNTPs (Thermo Fisher Scientific, Massachusetts, USA) (0.2 mM), forward (TGCTGCTGCTGATTACGAGCCGA) and reverse (TGTAGGAGGAGCCTCTTAGAGAA) primers (0.01 mM) (Jigsaw Biosolutions, Bengaluru, India), Taq Hot-Start DNA polymerase (Thermo Fisher Scientific, Massachusetts, USA) (1.25 U) and 1 μL
C. trachomatis DNA. The thermocycling parameters for
C. trachomatis-IMRS PCR assay was as indicated: 95°C for 3 min; 40 cycles of: 95°C for 30 s, 50°C for 30 s, 72°C for 30 s; and 72°C for 5 min and a final hold of 4°C. All PCR amplicons were resolved in 1% agarose gel and visualized on a UV Gel illuminator machine (Fison Instruments, Glasgow, United Kingdom) under ethidium bromide (Thermo Fisher Scientific, Massachusetts, USA) staining
19 (link)
.
Shiluli C., Kamath S., N. Kanoi B., Kimani R., Maina M., Waweru H., Kamita M., Ndirangu I., M. Abkallo H., Oduor B., Pamme N., Dupaty J., M. Klapperich C., Raju Lolabattu S, & Gitaka J. (2024). Multi-repeat sequences identification using genome mining techniques for developing highly sensitive molecular diagnostic assay for the detection of Chlamydia trachomatis. Open Research Africa, 7, 2.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!