Fast link ligation kit

Manufactured by Illumina

The Fast‐Link Ligation Kit is a laboratory product used for DNA ligation. It facilitates the joining of DNA fragments through a rapid and efficient ligation process. The kit includes the necessary reagents and buffers to perform DNA ligation reactions.

Automatically generated - may contain errors

Lab products found in correlation

Recombinant shrimp alkaline phosphatase, by New England Biolabs (1 mentions) Phusion hot start polymerase, by Thermo Fisher Scientific (1 mentions) T4 polynucleotide kinase, by New England Biolabs (1 mentions) E z n a gel extraction kit, by Omega Bio-Tek (1 mentions) Miseq system, by Illumina (1 mentions) Bioruptor, by Diagenode (1 mentions) Spin column, by Omega Bio-Tek (1 mentions) End it repair kit, by Illumina (1 mentions) Miseq next generation sequencing platform, by Illumina (1 mentions)

Spelling variants of this product

Fast-Link DNA Ligation Kit (9 citations)

4 protocols using fast link ligation kit

Overexpression Vector Construction for arpR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full‐length arpR gene including 146 bp of sequence upstream from the GTG start codon and 71 bp downstream from the stop codon were amplified from AB5075 genomic DNA by PCR (Phusion Hot‐Start Polymerase, Thermo Scientific). Primers arpR Exp.1 (5′‐CATTTAAATCGCTTATAACAC‐3′) and arpR Exp.2 (5′‐TTATCGCTCTTATTCAAACT‐3′) were phosphorylated prior to PCR amplification to add 5′ phosphates with T4 polynucleotide kinase (New England Biolabs). The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs). The ligation was electroporated into competent E. coli EC100D Transformax cells (Epicentre Biotechnologies). Plasmids that conferred tetracycline resistance but not ampicillin resistance were purified and confirmed by DNA sequencing prior to introduction into A. baumannii. This produced the expression vector parpR.

Tipton K.A., Farokhyfar M, & Rather P.N. (2016). Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075. MicrobiologyOpen, 6(2), e00418.

+ Open protocol

+ Expand

Targeted Genomic DNA Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA fragments encompassing nrde-1, nrde-2, nrde-4, wago-1, wago-9/hrde-1, mes-2, mes-3, mes-4, mes-6, hpl-2, set-25, set-32 were PCR amplified, spin-column purified using E.Z.N.A. Gel-Extraction Kit (Omega bio-tek), and suspended in 150μl of TE at 10ng/μl. The DNA was then sheared using Bioruptor (Diagenode) to approximately 300 bp long fragments (5 cycles of 30 sec. ON and 30 sec. OFF cycle, with intensity of M), and precipitated with ethanol precipitation. The ends of the DNA were fixed with End Repair Kit (Epicenter) following the instructions of the manufacturer, size selected using Agencourt AMPure XP size selection and purification kit (Beckman) following the kit instructions, and then A-tailed using Klenow (exo-) fragment (NEB). After AMPure purification, the fragments were ligated to pre-annealed Y-shaped adaptor (5′-P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3′, and 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ from IDT) using Fastlink Ligation Kit (Epicenter), purified again using the AMPure purification kit, and then subjected to PCR amplification using barcoded primers. PCR amplicons were purified by spin column (Omega biotek), mixed at equimolar concentration, and subjected to deep sequencing using Illumina MiSeq system (UMASS Medical School Deep Sequencing Core Facility).

Ishidate T., Ozturk A.R., Durning D.J., Sharma R., Shen E.Z., Chen H., Seth M., Shirayama M, & Mello C.C. (2018). ZNFX-1 Functions Within Perinuclear Nuage to Balance Epigenetic Signals. Molecular cell, 70(4), 639-649.e6.

+ Open protocol

+ Expand

ChIP-Seq Library Preparation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP material was then gel-purified and DNA fragments were blunt-ended and phosphorylated with the End-it-Repair kit (EPICENTRE). Illumina genome sequencing adaptors were ligated using the Fast-Link ligation kit (EPICENTRE) after the addition of adenosine nucleotide, using exo- Klenow. And samples were PCR amplified with Illumina genomic DNA sequencing primers. PCR products (250 to 450 bp in size) were gel purified and sent for Illumina GA2 “Solexa” sequencing at the UMass Worcester deep sequencing core facility.

Yildirim O., Hung J.H., Cedeno R.J., Weng Z., Lengner C.J, & Rando O.J. (2014). A System for Genome-Wide Histone Variant Dynamics In ES Cells Reveals Dynamic MacroH2A2 Replacement at Promoters. PLoS Genetics, 10(8), e1004515.

+ Open protocol

+ Expand

Amplification and Sequencing of Viral Integration Sites

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Integration site analysis was implemented based on standard ligation target amplification PCR and next-generation sequencing. Briefly, 500 ng of genomic DNA was sheared to an intermediate length of 500 ± 50 bp using the Covaris M220 Gene Fragmentation Instrument. After purification, the sheared DNA was extended by biotinylated 3′-long terminal repeat (3′-LTR)-specific primer (Primer 1) and captured by streptavidin-coated beads (Dynabeads^TMM-280; invitrogen). The captured genome was seeded to a ligation cassette including a sequencing barcode (UMI) according to the kit (Fast-Link Ligation Kit; Epicentre). Amplification of integration site was conducted via a procedure of two nested PCR. The first exponential PCR primers were referred to as Primer 2 and Primer 3. After magnetic capturing, the product underwent the second exponential PCR using Primer 4 (PE 2.0 UMI short). Primer sequences are summarized in the SupplemetaryTable 1.
The purified product proceeded to the subsequent Illumina Miseq next-generation sequencing platform for paired-end reads with parameter settings referenced in the literature^{56 (link),57 (link)}. Raw sequencing data were analyzed with Genome Integration Site Analysis Pipeline^{58 (link)} based on human reference genome GRCh38.

Yang S., Xu J., Dai Y., Jin S., Sun Y., Li J., Liu C., Ma X., Chen Z., Chen L., Hou J., Mi J.Q, & Chen S.J. (2024). Neutrophil activation and clonal CAR-T re-expansion underpinning cytokine release syndrome during ciltacabtagene autoleucel therapy in multiple myeloma. Nature Communications, 15, 360.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!