Purified RNA was reverse-transcribed using RevertAid (ThermoFisher, EP0441) and random hexamer primers. qPCRs were performed in triplicate using Brilliant III SYBR (Agilent Technologies) or Platinum SYBR (ThermoFisher). Primer sequences are provided in Table S4 .
Brilliant 3 sybr
Manufactured by Agilent Technologies
The Brilliant III SYBR is a real-time PCR reagent kit designed for sensitive and reliable gene expression analysis. It utilizes SYBR Green I dye to detect and quantify DNA amplification in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Plant rnaeasy kit, by Qiagen (2 mentions)
Ariamx qpcr machine, by Agilent Technologies (2 mentions)
Rq1 dnase, by Promega (2 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Ambion turbo dna free, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rlt buffer, by Qiagen (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
4 protocols using brilliant 3 sybr
1
RNA Reverse Transcription and qPCR
2
Quantitative Gene Expression Analysis in Arabidopsis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Arabidopsis seedlings were frozen in liquid nitrogen and ground to a fine powder. RNA was extracted using the Qiagen Plant RNAeasy kit as per manufacturers recommendations. RNA was quantified using a Thermo Scientific NanoDropTM 1000 Spectrophotometer. 1.5 µg of RNA was treated with RQ1 DNase (Promega- M6101) as per manufacturers recommendations. cDNA was synthesized using oligo dT or random hexamers (for analysis of chloroplast encoded petL and -G transcripts) and SuperScript® II Reverse Transcriptase. cDNA was assessed for genomic DNA contamination using intron spanning primers for ACTIN7. Quantitative PCR primers were designed using the NCBI primer BLAST82 and primer annealing was tested using gradient PCR. Relative expression was compared between genotypes and treatments using target primers and primers to the housekeeping gene ACTIN7 for normalization (For primer sequences see, Supplementary Data 3 ). Agilent Brilliant III SYBR was used in conjunction with Agilent Aria MX qPCR machine and analysis performed using the ∆∆CT comparative quantification method83 (link).
3
iPSC-Derived Macrophage Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Freshly harvested iPSC-MΦ were either pelleted and lysed directly or plated at 7 × 105 cells/well in a 12-well in macrophage media and cultured for 6 h in presence or absence of 100 ng/mL LPS, 10 µM zVAD-fmk and/or 3 µM GSK before being lysed in the plate. Cells were lysed using RLT buffer (QIAGEN) supplemented with 10 µL β-ME. RNA extraction was performed using the RNeasy® kit (QIAGEN) according to manufacturer’s protocol. Potential DNA contamination was removed by adding a step of Ambion® TURBO DNA-free® according to manufacturer’s protocol (Life technologies). Reverse transcription was performed using the High capacity RNA-to-cDNA kit (Applied Biosystems™) according to manufacturer’s protocol. qPCR was performed using Brilliant III SYBR® (Agilent) on the Applied Biosystems® StepOnePlus™ Real-Time PCR System. The Following primers were used:
| Target | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|
| TATABox protein | GAACCACGGCACTGATTTTC | CCCCACCATGTTCTGAATCT |
| RIPK1 | TTACATGGAAAAGGCGTGATACA | AGGTCTGCGATCTTAATGTGGA |
| TNFα | TGTTGTAGCAAACCCTCAAGC | TATCTCTCAGCTCCACGCCA |
| IL1-β | AAAGCTTGGTGATGTCTGGTC | GGACATGGAGAACACCACTTG |
4
Arabidopsis Transcriptional Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Arabidopsis seedlings were frozen in liquid nitrogen and ground to a fine powder. RNA was extracted using the Qiagen Plant RNAeasy kit as per manufacturers recommendations. RNA was quantified using a Thermo Scientific NanoDropTM 1000 Spectrophotometer. 1.5µg of RNA was treated with RQ1 DNase (Promega-M6101) as per manufacturers recommendations. cDNA was synthesized using oligo dT or random hexamers (for analysis of chloroplast encoded petL and -G transcripts) and SuperScript® II Reverse Transcriptase.
cDNA was assessed for genomic DNA contamination using intron spanning primers for ACTIN7. Quantitative PCR primers were designed using the NCBI primer BLAST (Geer et al., 2010) and primer annealing was tested using gradient PCR. Relative expression was compared between genotypes and treatments using target primers and primers to the housekeeping gene ACTIN7 for normalization (For primer sequences see, Data sheet 3).
Agilent Brilliant III SYBR was used in conjunction with Agilent Aria MX qPCR machine and analysis performed using the ∆∆CT comparative quantification method (Livak and Schmittgen, 2001) .
cDNA was assessed for genomic DNA contamination using intron spanning primers for ACTIN7. Quantitative PCR primers were designed using the NCBI primer BLAST (Geer et al., 2010) and primer annealing was tested using gradient PCR. Relative expression was compared between genotypes and treatments using target primers and primers to the housekeeping gene ACTIN7 for normalization (For primer sequences see, Data sheet 3).
Agilent Brilliant III SYBR was used in conjunction with Agilent Aria MX qPCR machine and analysis performed using the ∆∆CT comparative quantification method (Livak and Schmittgen, 2001) .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!