Sh snhg3 1

PC3 or DU145 cells at the confluence of 50%‐80% were collected and transfected with the shRNAs (short hairpin RNAs) specific to SNHG3 (sh‐SNHG3#1 and sh‐SNHG3#2) or sh‐NC (negative control) (Genepharma, SC, CA, USA). Simultaneously, miR‐577 mimics and NC‐mimics were constructed by RiboBio. The pcDNA3.1 targeting SMURF1 and empty pcDNA3.1 vector were purchased from Genechem (Shanghai, China). Transfection was performed with Lipofectamine 3000 (Invitrogen). Relevant sequences were provided in Table S1.

Two short hairpin RNAs (shRNAs) targeting lncRNA SNHG3 (shSNHG3‐1 and shSNHG3‐2) and negative control (shCtrl) were purchased from GenePharma (Suzhou, China). The shlncRNA SNHG3‐1 sequence was as follows: 5′‐GGGCACTTCGTAAGGTTTAAA‐3′; the shlncRNA SNHG3‐2 sequence was as follows: 5′‐GGTTGAGTGCAAGATGAGTTA‐3′.²¹ miR‐515‐5p inhibitor (miR inhibitor) and its negative control (miR‐NC) were ordered from RiboBio (Guangzhou, China). All cell transfections were performed by Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer. Plasmids construction and pcDNA3.1‐lncRNA SNHG3 were synthesized by GenePharma (Suzhou, China). For stable transfection, cell lines were all selected for at least 2 weeks with 300 μg/mL of neomycin.