Primescript real time pcr kit

Total RNA was extracted from different tissues using Trizol reagent (RNA Extraction kit, Invitrogen, CA, USA) according to the manufacturer’s protocol. The concentration and quality of total RNA were estimated by the spectrophotometry (absorbance at 260 nm) and agarose gel electrophoresis, respectively. Total RNA (2 μg) isolated from the gonad was reverse transcribed using the SMART™ cDNA kit (Clontech, CA, USA) for cDNA cloning, and then the PrimeScript Real-time PCR kit (TaKaRa, Toyama, Japan) was used for RT-qPCR experiments, respectively. All the primers used in this study were synthesized by Shanghai Invitrogen Biotech Co Ltd. (Invitrogen, Shanghai, China) and are listed in Table 1.

Total RNA was extracted from muscle, hepatopancreas, haemopoietic tissue, gill, and haemocytes and reverse transcribed into cDNA using the Prime-Script™ real-time PCR kit (Takara, Japan) according to the instructions. The spatial distribution of EsALF-1 and EsALF-3 mRNA in the five tissues, and the mRNA expressions of EsALF-1, EsALF-3, EsMy88, EsPelle, and EsTLR1 in haemocytes after immune priming or knockdown of EsTLR1 expression were determined by qRT-PCR with specific primers (Table 1), respectively. The qRT-PCR reactions were conducted with an ABI PRISM 7500 Sequence Detection System (Applied Biosystems) using SYBR green fluorescent (Takara, Japan) according to the instruction. A 267 bp fragment of Esβ-actin (GenBank accession No. HM053699) amplified with the specific primers, Esβ-actin-RT-F and -R (Table 1) was employed as endogenous control. The qRT-PCR reactions operated as follows: 95°C for 10 min, followed by 40 cycles at 95°C for 10 s and 60°C for 45 s. To confirm the specificity of PCR products, the dissociation curve analysis of amplification products was performed at the end of each PCR. The relative mRNA expression level was analyzed by comparative Ct method (2 ^-△△Ct method) (22 (link)).

Total RNA was isolated from tissue or cells using TRIzol reagent (Invitrogen) and was then reverse‐transcribed into cDNA using PrimeScript real‐time PCR kit (TaKaRa Biotechnology). The real‐time PCR amplification was performed using a SYBR Green PCR Master Mix (TaKaRa) on the ABI 7900 Prism HT (Applied Biosystems). GAPDH was used to internally normalize the expression level of each candidate gene. The relative quantitative comparison between groups was evaluated using the 2^−ΔΔCt method.¹⁵, ²⁴, ²⁵, ²⁶ Primers for real‐time PCR were as follows: LOC101928477: forward 5′‐CTGCAAGTTTGGGGGTGAAC‐3′, reverse 5′‐ACTGTGGCGAGGTGATATGG‐3′, GAPDH forward 5′‐GGAGCGAGATCCCTCCAAAAT‐3′, reverse 5′‐GGCTGTTGTCATACTTCTCATGG‐3′.