To increase the concentration of RNA, extractions were randomly pooled into groups of 3–5 animals for sequencing, using 25ul of each extraction in each pool. This pooled RNA was concentrated using the NucleoSpin RNA Clean-up XS, Micro kit for RNA clean up and concentration (Machery-Nagel). The concentrated RNA was eluted into 20ul of sterile water. The Stranded Total RNA Prep with Ribo-Zero Plus (Illumina) kit was used to prepare the cDNA libraries for paired-end sequencing on the Illumina Novaseq 6000 platform. Using two lanes, each sample was sequenced once on each lane and the reads were combined from both lanes for each sample.
Rneasy plus mini extraction kit
The RNeasy Plus Mini Kit is a product designed for the purification of total RNA from various sample types. It utilizes a silica-membrane-based technology to efficiently capture and isolate RNA molecules. The kit includes buffers and reagents necessary for the extraction and purification process.
Lab products found in correlation
15 protocols using rneasy plus mini extraction kit
RNA Extraction and Sequencing
To increase the concentration of RNA, extractions were randomly pooled into groups of 3–5 animals for sequencing, using 25ul of each extraction in each pool. This pooled RNA was concentrated using the NucleoSpin RNA Clean-up XS, Micro kit for RNA clean up and concentration (Machery-Nagel). The concentrated RNA was eluted into 20ul of sterile water. The Stranded Total RNA Prep with Ribo-Zero Plus (Illumina) kit was used to prepare the cDNA libraries for paired-end sequencing on the Illumina Novaseq 6000 platform. Using two lanes, each sample was sequenced once on each lane and the reads were combined from both lanes for each sample.
Measuring 11-Gene ACS COR Signature in PBMCs
Quantitative Real-Time RT-PCR Analysis of Ovarian Tissue
RNA Extraction and Sequencing Protocol
RNA Extraction from Swab Samples
Quantitative Analysis of Kidney Fibrosis Markers
PCR primer sequences.
Target | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
LOXL2 | ATTAACCCCAACTATGAAGTG | CTGTCTCCTCACTGAAGGCTC |
Fibronectin | ACAGAAATGACCATTGAAGG | TGTCTGGAGAAAGGTTGATT |
COL1A1 | CATGTTCAGCTTTGTGGACCT | GCAGCTGACTTCAGGGATGT |
Col IV | TTAAAGGACTCCAGGGACCAC | CCCACTGAGCCCTGTCACAC |
aSMA | ATAGGTGGTTTCGTGGATGC | ACTCTCTTCCAGCCATCTTTCA |
E-Cadherin | CAAAGTGACGCTGAAGTCCA | TACACGCTGGGAAACATGAG |
β-Actin | CTAAGGCCAACCGTGAAAAG | ACCAGAGGCATACAGGGACA |
RNA Extraction from Small Invertebrates
Extraction and Sequencing of RNA
RNA Extraction and qPCR Analysis
Gene Expression Analysis via qRT-PCR
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!