Direct zol rna miniprep kit

Tissues were isolated and immediately frozen in liquid nitrogen before storing in −80°C or put in TRI Reagent (Sigma) for RNA extraction immediately. Total RNA was extracted by TRI Reagent (Sigma) or Direct-zol RNA Miniprep Kit (Genesee Scientific), and RNA was reverse-transcribed by Superscript IV (Invitrogen) or RNA to cDNA EcoDry Premix (Oligo dT; Takara). PCR was carried out using QuantiFast SYBR Green PCR Kit (Qiagen) or SYBR Green PCR Master Mix (Applied Biosystems). The expression levels of target genes were normalized to the levels of reference genes, ribosomal protein L13 alpha (rp113a) or tubulin (Tang et al., 2007 (link)). The relative expression ratio of each target gene to the reference was normalized to the control group (2^-∆∆ct method). All qRT-PCR assays in a particular experiment were undertaken at the same time under identical conditions and performed in triplicate. Primer sequences used for gene amplification are listed in Supplementary file 1B.

Lung adenocarcinoma and normal lung tissue samples, obtained from resected lung cancer specimens from patients who had surgery at MD Anderson Cancer Center, were homogenized using Omni plastic disposable probes and an Omni (TH‐115) homogenizer (Omni International, Warrenton, VA) for 1 minute on dry ice. Total RNA was isolated from the cells using the Direct‐zol™ RNA Miniprep kit from Genesee Scientific (San Diego, CA) and samples homogenized using Trizol reagent according to the manufacturer's instructions. Total RNA was quantified using the Nanodrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE). RNA quality was assessed based on RNA integrity numbers generated by the Agilent Bioanalyzer 2000 (Agilent Technologies, Palo Alto, CA) according to the manufacturer's instructions.

RNA was extracted using Tri-reagent and isolated with the Direct-Zol RNA miniprep kit (Genesee Scientific). For adipose tissue, the RNeasy Lipid Tissue mini kit (Qiagen) was used. cDNA was synthesized using the High Capacity cDNA RT kit (Life Technologies). Transcripts were analyzed using a Roche LightCycler 480 II in 384-well plates and the UPL probe system. Bioline SensiFast Probe No-ROX was used as a master mix. Primer sequences and respective probes were as follows: Cdkn2a (p16), forward 5’-TCCTCGCAGTTCGAATCTG, reverse 5’-AACTCTTTCGGTCGTACCCC, with a custom designed probe (5'- /56-FAM/AGG TGA TGA /ZEN/TGA TGG GCA ACG TTC AC/3IABkFQ/ -3'); Cdkn1a (p21) variant 1, forward 5’-TCCACAGCGATATCCAGACA, reverse 5’-GGACATCACCAGGATTGGAC, with UPL probe 21; Cdkn1a (p21) variant 2, forward 5’-TTGCCAGCAGAATAAAAGGTG, reverse 5’-TTTGCTCCTGTGCGGAAC, with UPL probe 9; β-actin: forward 5’- CTAAGGCCAACCGTGAAAAG, reverse 5’- ACCAGAGGCATACAGGGACA, with UPL probe 64; tubulin: forward 5’- CTGGAACCCACGGTCATC, reverse 5’- GTGGCCACGAGCATAGTTATT, UPL probe 88. Results were normalized to β-actin and tubulin. ΔΔCt values prior to logarithmic transformation were used for statistical analyses.

Total RNA was prepared from human astrocytes using a Direct-zol RNA MiniPrep Kit (Genesee Scientific). Integrity of RNA was verified using a nanodrop system. RT-qPCR was performed using the Universal Probe Library System (Roche, South San Francisco, CA) with the following primers and probes:
IL-1a: forward (FW) 5′-ggttgagtttaagccaatcca-3′; reverse (RV) 5′-tgctgacctaggcttgatga-3′
p16^INK4a: FW 5′-cggaaggtccctcagacatc-3′; RV 5′-aaactacgaaagcggggtgg-3′
p21: FW 5′-ccagcatgacagatttctaccac-3′; RV 5′- cttcctgtgggcggattagg-3′
actin: 5′-ACCGAGCGCGGCTACAG-3′; 5′-CTTAATGTCACGCACGATTTCC-3′