Endometriosis epithelial cells 11Z were established by Prof. Anna Strazinski-Powitz [24 (link)]. Stromal cell ESC was established by Dr. Krikum [25 (link)]. HEK293T cells were purchased from the American Type Culture Collection (ATCC). Endometriosis cells were cultured in the F12/DMEM medium (Corning) while HEK293T cells were in the DEME medium (Corning). Primary mouse embryonic fibroblast was isolated as previously described and suspended in DMEM medium. All cells were cult cultured at 37 C in 5% CO2 (v/v). All cell lines were passaged less than 15 times. Mycoplasma detection on cells every 2 months.
Hek293t cells
Manufactured by Corning
Sourced in United States, China
HEK293T cells are an immortalized cell line derived from human embryonic kidney cells. They are commonly used in research and biotechnology applications due to their high transfection efficiency and ease of culture.
Automatically generated - may contain errors
Lab products found in correlation
Hek293t cell, by American Type Culture Collection (12 mentions)
Dulbecco modified eagle medium (dmem), by Corning (8 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (8 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (6 mentions)
Fetal bovine serum (fbs), by Merck Group (6 mentions)
Fetal bovine serum (fbs), by Corning (4 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions)
Dulbecco s modified eagle s medium, by Corning (3 mentions)
Fetal bovine serum (fbs), by Avantor (3 mentions)
T 225 flasks, by Corning (2 mentions)
Hek293t cells, by Thermo Fisher Scientific (2 mentions)
Virapower packaging virus, by Thermo Fisher Scientific (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Opti mem medium, by Thermo Fisher Scientific (2 mentions)
Bovine serum albumin (bsa), by Merck Group (2 mentions)
Rpmi 1640 medium, by Corning (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Sf 900 2 sfm medium, by Thermo Fisher Scientific (2 mentions)
Amphotericin b, by Corning (2 mentions)
Opti mem, by Thermo Fisher Scientific (2 mentions)
24 protocols using hek293t cells
1
Endometriosis and HEK293T Cell Culture
2
Lentivirus Production in HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells (ATCC, USA) were grown in DMEM and 10% FBS (Gibco, UK). 24 hours ahead of transfection with the library vectors, HEK293T cells were seeded into T225 flasks (Corning) at 40% confluency. The following day, the cells were transfected with the library plasmids using Lipofectamine 3000 (Invitrogen, USA) and Virapower packaging virus (LifeTechnologies, UK) in accordance with the manufacturer’s instructions. Briefly, the medium was removed from the HEK293T cells and the DNA–lipid mix was added to the cells in Optimem medium (Gibco, UK) and left for 6 hours, after which the transfection mix was removed and replaced with DMEM containing 10% FBS and 1% BSA (Sigma-Aldrich). The medium was harvested 48 hours later and centrifuged at 500 × g for 10 min at 4 °C and then filtered using a 0.45 μm low protein-binding filter (Millex Durapore PVDF HF). The virus was further concentrated using Lenti-X concentrator (Clontech #631232) in accordance with the manufacturer’s instructions. The viral supernatant was aliquoted and stored at −80 °C in DMEM with 10% FBS and 1% BSA.
3
Base Editing in E. coli and HEK293T
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Base editing was performed by transformation of E. coli BL21(DE3) competent cells with 500 ng of plasmids encoding base editors. After heat shock, transformed E. coli cells were incubated in 2× yeast extract-tryptone (YT) medium (containing 0.6 mM IPTG) at 37°C with shaking at 220 rpm for 45 min. Cells were then spread on 2× YT agar plates (containing 50 μg/ml ampicillin and 0.6 mM IPTG). The plate then was incubated at 37°C overnight (∼14 h) to obtain single colonies. HEK293T cells were obtained from the American Type Culture Collection. Cells were cultured in Dulbecco’s modified Eagle medium (DMEM) (Gibco) with 10% heat-inactivated fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco). Cells were maintained in a 37°C incubator with 5% CO2. HEK293T cells were seeded on 6-well plates (Corning) and transfected at approximately 60% confluence. Three micrograms of BE3 and 1 μg of sgRNA expression plasmids were transfected using 8 μl of Lipofectamine 3000 (ThermoFisher Scientific) per well according to the manufacturer’s protocol.
4
Cell Culture Protocols for Bladder Cancer and Control Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human bladder cancer cells (5637, T24, UMUC-3), human immortal ureteral epithelium immortalized cells (SV-HUC-1), and HEK-293T cells were purchased from the American Type Culture Collection (ATCC). 5637 and T24 cells were cultured in RPMI-1640 medium (Corning) with 10% fetal bovine serum (FBS, Gbico, USA), UMUC-3 cells were cultured in MEM medium (ScienCell, Shanghai, China) with 10% FBS, SV-HUC-1 cells were cultured in F12K medium (ScienCell, Shanghai, China) with 10% FBS, and HEK-293T cells were cultured in DMEM medium (Corning) with 10% FBS. All cell cultures were incubated at 37 °C in a humidified atmosphere with 5% CO2. STR certificates for cell lines were listed in Supplementary file 1 –4 .
5
CRISPR-Cas9 Transfection in HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) + GlutaMAX-I (4.5 g/l D glucose +110 mg/ml sodium pyruvate) supplemented with 10% fetal bovine serum (FBS, Life Technologies, Carlsbad, CA, USA). Cells were cultured at 37°C at 5% CO2 in a humidified incubator.
Plasmids used for transfections were isolated from PureYield Plasmid Miniprep System (Promega, Madison, WI, USA). The night before transfections, HEK293T cells were seeded at a density of 3 × 105 cells per well in 48 well collagen-treated plates (Corning, NY, USA). Transfection reactions were prepared in 25 μl of Opti-MEM (ThermoFisher Scientific, Waltham, MA, USA). For each transfection, 45 ng of each guide RNA expression vector, 9 ng of reporter plasmid, 9 ng of piRFP670-N1 (Addgene Plasmid 45457) and 160 ng of recCas9 expression vector were mixed, combined with 0.8 μl lipofectamine 2000 in Opti-MEM (ThermoFisher Scientific, Waltham, MA, USA) and added to individual wells.
Plasmids used for transfections were isolated from PureYield Plasmid Miniprep System (Promega, Madison, WI, USA). The night before transfections, HEK293T cells were seeded at a density of 3 × 105 cells per well in 48 well collagen-treated plates (Corning, NY, USA). Transfection reactions were prepared in 25 μl of Opti-MEM (ThermoFisher Scientific, Waltham, MA, USA). For each transfection, 45 ng of each guide RNA expression vector, 9 ng of reporter plasmid, 9 ng of piRFP670-N1 (Addgene Plasmid 45457) and 160 ng of recCas9 expression vector were mixed, combined with 0.8 μl lipofectamine 2000 in Opti-MEM (ThermoFisher Scientific, Waltham, MA, USA) and added to individual wells.
6
HEK293T Cell Transient Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells (30 passages) were obtained from American Type Culture Collection (Manassas, VA, USA). These cells were cultured in Dulbecco’s modified Eagle’ medium (Corning Incorporated, Corning, NY, USA) containing 10% fetal bovine serum (Gibco, Carlsbad, CA, USA) and 1% penicillin/streptomycin (Gibco) at 37 °C in 5% CO2. For transient transfection, HEK293T cells were seeded at 96-well plates (Corning) overnight. Plasmids were mixed with TransIT®-LT1 transfection reagent (Mirus Bio LLC, Madison, WI, USA) and the plasmid and reagent mixture were added to cells according to the manufacturer’s instructions.
7
Cell Culture of HEK293T and CRC Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human embryonic kidney cell lines (HEK293T cells) and human colorectal cancer cell lines (HCT-116 and DLD-1 cells) were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China) and cultured in Dulbecco’s modified eagle’s medium (DMEM, Corning, USA) supplemented with 10% fetal bovine serum (BioInd, Israel) and 1% penicillin streptomycin (Invitrogen, USA).
8
Establishment and Validation of HMMR Knockdown in Lung Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human bronchial epithelial cell line (BEAS2B) and the LUAD cell lines were purchased from the Cell Bank of Kunming Institute of Zoology and cultured in bronchial epithelial cell growth medium (BEGM) (CC-3170; Lonza, Basel, Switzerland). The HEK-293T cell line was obtained from the American Type Culture Collection (ATCC). The lung cancer cell lines A549, H1299, and H1975 were purchased from Cobioer (Nanjing, China) with short tandem repeat (STR) document. A549, H1299, and H1975 cells were all cultured in RPMI 1640 medium (Corning, Corning, NY, USA) supplemented with 10% fetal bovine serum (cat. no. 10099141C; Gibco, Waltham, MA, USA) and 1% penicillin/streptomycin. HEK-293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Corning). The short hairpin RNA (shRNA) for HMMR was constructed using pLKO.1 vector. The shRNA for the HMMR primer sequences are as follows: HMMR shRNA#1: AAACAGCTGGAAGATGAAGAAGGAA; HMMR shRNA#2: CAGCTGGAAGATGAAGAAGGAAGAA.
9
Cell Lines and Virus Propagation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells, Vero cells, BHK cells and HUVEC were purchased from the American Type Culture Collection (ATCC). EA.hy926 cells were purchased from the tissue culture facility at the University of North Carolina at Chapel Hill. 293FT cells were purchased from Thermo Fisher. iSLK.219 cells were a kind gift from Don Ganem. HEK293T cells, Vero cells, BHK cells, 293FT cells, and EA.hy926 cells were maintained in Dulbecco’s minimal essential medium (DMEM) (Corning) containing 10% fetal bovine serum (FBS) (Sigma) and 1% penicillin-streptomycin (Pen-Strep) (Corning). HUVEC were maintained in EGM-2 supplied with growth factors obtained from the EGM-2 Bullet kit (Lonza). iSLK.219 cells were maintained in DMEM containing 10% tetracycline (Tet)-free FBS (Sigma), 1% Pen-Strep, 10 μg/ml puromycin (Corning), 50 μg/ml Geneticin (Corning), and 100 μg/ml hygromycin B (Corning). All cells were maintained at 37°C in a 5% CO2 laboratory incubator which was subject to routine cleaning and decontamination. HSV-1 (KOS strain) was obtained from ATCC and propagated in Vero cells. VSV was a kind gift from Doug Lyles and was propagated in BHK cells. KSHV was purified form iSLK.219 cells in our lab.
10
Mammalian Cell Culture and Plasmid Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human embryonic kidney HEK293T cells (CRL-3216) and human colorectal adenocarcinoma SW480 (CCL-228) and HCT116 cells (CCL-247) were obtained from American Type Culture Collection. HEK293T cells were maintained in DMEM (Corning) supplemented with 10% FBS (Gibco) at 37°C in a humidified, 5% CO2 incubator. HCT116 cells were maintained in McCoy’s 5a Modified Medium (Corning) supplemented with 10% FBS, while SW480 cells were maintained in Leibovitz’s L-15 Medium (Corning) supplemented with 10% FBS without CO2. Cell transfection was conducted with VigoFect (Vigorous Biotechnology) or Lipofectamine 2000 (Invitrogen).
All plasmids used in this study were generated by subcloning corresponding cDNAs into HA-pcDNA3.1 (for mammalian cell expression), pET32M.3C, pETMBP.3C (for bacteria expression), or pCS107-HA (for in vitro transcription) vectors. The sequences encoding human Axin1 (NCBI RefSeq no. NM_181050.3), human APC (NM_000038.6), human GSK3β (NM_001146156.2), β-catenin (NM_001098209.2), and human CK1α (NM_001025105.3) were amplified using standard PCR procedures with cDNA from HEK293T cells and subcloned into HA-pcDNA3.1, pETMBP.3C, and pCS107-HA vectors. Drosophila melanogaster dAPC2 (NM_001347814.1) was amplified and subcloned into pETMBP.3C vectors. Plasmids encoding Axin1 deletions or mutations were generated by PCR using primers with appropriate nucleotide substitutions.
All plasmids used in this study were generated by subcloning corresponding cDNAs into HA-pcDNA3.1 (for mammalian cell expression), pET32M.3C, pETMBP.3C (for bacteria expression), or pCS107-HA (for in vitro transcription) vectors. The sequences encoding human Axin1 (NCBI RefSeq no. NM_181050.3), human APC (NM_000038.6), human GSK3β (NM_001146156.2), β-catenin (NM_001098209.2), and human CK1α (NM_001025105.3) were amplified using standard PCR procedures with cDNA from HEK293T cells and subcloned into HA-pcDNA3.1, pETMBP.3C, and pCS107-HA vectors. Drosophila melanogaster dAPC2 (NM_001347814.1) was amplified and subcloned into pETMBP.3C vectors. Plasmids encoding Axin1 deletions or mutations were generated by PCR using primers with appropriate nucleotide substitutions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!