Pyromark q24 v2
The PyroMark Q24 v2.0.6 is a real-time pyrosequencing system designed for DNA sequence analysis. It is capable of performing automated pyrosequencing reactions and generating sequence data.
Lab products found in correlation
5 protocols using pyromark q24 v2
Pyrosequencing Amplification Bias Test
Pyrosequencing of FANCM Gene
pFANCMR:TTTCGTTGGCTAAATCTTCTTCCT,
pFANCMF:ACGAAGCAAACAGAGAAGAAGACC,
pFANCMS:TCTTCTGCCAATTCATTA
Allele-Specific Pyrosequencing Protocol
Quantitative DNA Methylation Validation
Pyrosequencing Methylation Analysis Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!