Pyromark q24 v2

For pyrosequencing, cDNA and genomic DNA was used to test for amplification bias. The primers utilized were PS_MSH41F (5′-TGCTCAGATTGGCTGCTATGT-3′) as forward primer, PS_MSH4R (5′-TTCTTGTGAATATGCGGTCAAC-3′) as reverse primer and PS_MSH4S (5′-CAACCACACGCATAGT-3′) as sequencing primer. Pyrosequencing reaction was performed with PyroMark Q24 v2.0.6 (Qiagen).

Pyrosequencing was performed on meiotic cDNA and on gDNA to check for amplification bias. The following primers were used for amplification and sequencing:

pFANCMR:TTTCGTTGGCTAAATCTTCTTCCT,

pFANCMF:ACGAAGCAAACAGAGAAGAAGACC,

pFANCMS:TCTTCTGCCAATTCATTA

Primer pairs have been designed with Pyromark Assay Design v2.0.1.15 and the pyrosequencing reaction has been performed with PyroMark Q24 v2.0.6 of QIAGEN®.

To determine relative expression of alternate allele’s pyrosequencing was performed [97 (link)]. Both PCR and sequencing primers were designed using PyroMark Assay Design Software. Reverse PCR primer was biotin-labeled to enable mobilization of streptavidin-coated beads. The RT-PCR was performed using 2 μl cDNA in a standard 50 μl reaction set up containing: PyroMark PCR master mix (2X) 25 ul, and Primer mix (10X) 5 ul, following manufacturer’s instructions (PyroMark PCR kit (Qiagen#978703). Coral Load concentrate provided in the kit was avoided. PCR conditions were 2 min at 95°C, followed by 40 cycles of 30 sec at 94°C, 30 sec at 60°C, 30 sec at 72°C, and final extension of 10 min at 72°C. The products were sequenced according to PyroMark Q24 system (Qiagen) with 0.4 μM of specific pyrosequencing primers and pyrograms were analysed with the software PyroMark Q24 V.2.0.6 (Qiagen).