Pfu ultra 2

Manufactured by Agilent Technologies

Sourced in United States, Canada

The Pfu Ultra II is a high-fidelity DNA polymerase from Agilent Technologies. It is designed for use in a variety of PCR applications that require accurate DNA replication.

Automatically generated - may contain errors

Lab products found in correlation

13 protocols using pfu ultra 2

Codon-Optimized KPNA7 Expression and NLS Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human KPNA7 protein sequence was codon-optimized for E. coli (Genewiz) and cloned into pMBPHis-Parallel1^{65 (link)} for expression as a maltose binding protein fusion. PCR mutagenesis was performed using Pfu Ultra II (Agilent) to introduce the P339A and E344Q amino acid substitutions. The NLS sequences used in this study (SV40, DDB2, hnRNP R mNLS, hnRNP R bNLS, hnRNP U) were cloned into the pGEX-4T1-GFP vector. Flag-myc-hnRNP R plasmid (RC224502) was obtained from OriGene. Mutagenesis PCR was performed using Pfu Ultra II (Agilent) to generate the NLS mutant constructs. The CTCF expression construct^{66 (link)} is in the pMAL-c2g backbone, which contains Zinc fingers 4–8 of human CTCF, and was a gift from Gary Felsenfeld (NIH).

Oostdyk L.T., Wang Z., Zang C., Li H., McConnell M.J, & Paschal B.M. (2020). An epilepsy-associated mutation in the nuclear import receptor KPNA7 reduces nuclear localization signal binding. Scientific Reports, 10, 4844.

+ Open protocol

+ Expand

Generation of Arabidopsis Overexpression Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

p35S:NF-YB2 and p35S:NF-YB3 were previously described [26 (link)]. All other NF-YB full-length, HFD, and domain swap constructs were amplified from cDNA using the proof-reading enzyme Pfu Ultra II (Agilent Technologies cat#600670–51) and cloned into the Gateway^™ entry vector pENTR/D-TOPO (Invitrogen, cat#45–0218). All constructs were sequenced and found to be identical to the sequences at The Arabidopsis Information Resource (TAIR) [40 (link)]. Plant overexpression constructs were created using the Gateway^™ LR Clonase II kit (Invitrogen, cat#56485) and subcloned into pEarlyGate101 (ABRC, stock#CD3-683). Plant transformation was done by using the Agrobacterium-mediated floral dip method as previously described [47 (link)].

Siriwardana C.L., Risinger J.R., Carpenter E.M, & Holt BF I.I.I. (2023). Analysis of gene duplication within the Arabidopsis NUCLEAR FACTOR Y, subunit B (NF-YB) protein family reveals domains under both purifying and diversifying selection. PLOS ONE, 18(8), e0289332.

+ Open protocol

+ Expand

Directed Evolution of Shuffled AAV Capsids

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

A shuffled AAV capsid was created as described^{17 (link)} using the following parent capsids as starting material: AAV1, AAV2, AAV2i8,^{21 (link)} AAV2.5,^{22 (link)} AAV6, AAV8, AAV9, AAV9.47,^{23 (link)} AAVrh10 and capsids recovered from unrelated ongoing shuffling projects.³² The shuffled library was injected intravenously into rats that previously received a striatal 6-OHDA treatment. Three days later, the rats were killed and striatal cells were mechanically dissociated. DNA was recovered from neuron-enriched samples using the Qiagen DNeasy blood and tissue kit (Venlo, Netherlands) and subsequently concentrated by ethanol precipitation. Intact capsid library sequences were recovered by PCR using a high-fidelity polymerase, Pfu Ultra II (Agilent, Santa Clara, CA, USA), with primers SwaICapUP 5′-GCGAATGATTTAAATCAGGTATGGCTGC-3′ and P4ext 5′-AAGCTCTAGACGGACACCAAAGTTCAACT-3′. A subsequent error-prone PCR step was employed to further diversify the library between rounds. Cloning and library amplification between selection rounds was carried out as previously described.^{17 (link)} A total of two rounds of selection were performed. Recovered clones after each round were subcloned into rAAV pXR2 backbones and SSV9 replication-competent backbones and sequenced.

Powell S., Khan N., Parker C., Samulski R., Matsushima G., Gray S, & McCown T. (2016). Characterization of a novel adeno-associated viral vector with preferential oligodendrocyte tropism. Gene therapy, 23(11), 807-814.

+ Open protocol

+ Expand

Recombinant Protein Expression and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Standard methods were used for protein expression in E. coli and purification on TALON (Clontech) and Glutathione (Sigma) beads. The pET-DUET1 plasmid (Novagen) was used for co-expression of human His6-Parp9 and untagged human Dtx3L in the strain BL21(DE3)pLysS at 18°C overnight. Expression of His-Parp9 and Dtx3L in Sf9 insect cells was performed using the pBacPAK8 plasmid (Clontech). Plasmids were co-transfected with linearized BacPAK6 DNA to prepare the initial baculovirus, which was amplified using standard protocols. The pET28a plasmid was used to make His-T7-Ub and its mutant derivatives (H68G, R72G, R74G). PCR mutagenesis was performed using Pfu Ultra II (Agilent). The pGEX plasmid 4T-2 was used to express AF1521 protein. MDM2, p53, RNF146, ISG15, and Uba52 were expressed and purified by standard methods. Recombinant histones were purified by column chromatography following published procedures (Luger et al., 1999). Proteins purchased from commercial sources included WT-Ub (Sigma U6253 and U5507, AbD serotec 94001502, or R & D system U-530), K29,48,63R-Ub (Boston Biochem UM-3KTR), G75,76A-Ub (Boston Biochem UM-HAA), E1 Ube1 (R&D System E304), E2 UbcH8 (R&D System E2-616), and biotin-tagged WT-Ub (R&D U-570–100).

Yang C.S., Jividen K., Spencer A., Dworak N., Ni L., Oostdyk L.T., Chatterjee M., Kusmider B., Reon B., Parlak M., Gorbunova V., Abbas T., Jeffery E., Sherman N.E, & Paschal B.M. (2017). Ubiquitin Modification by the E3 Ligase/ADP-ribosyltransferase Dtx3L/Parp9. Molecular cell, 66(4), 503-516.e5.

+ Open protocol

+ Expand

Engineered pHIS-Parallel GAF-A Construct

Check if the same lab product or an alternative is used in the 5 most similar protocols

We designed a construct analogous to the pHIS-Parallel [16 ] construct used for previous DosS GAF-A domain crystal structure determinations [15 (link)]. The GAF-A domain consisting of nucleotides encoding amino acids 63–210 followed by a stop codon was synthesized by Genewiz, Inc. (Berkeley, CA) and was provided in a pUC57 plasmid. The insert, containing a 5’ histidine tag followed by a spacer, TEV cleavage site, and the GAF-A domain, was flanked by NdeI and EcoRI restriction sites. The resulting protein product was identical to that previously reported except for the loss of a Glu prior to amino acid 63, resulting in four additional amino acids (Met-Ser-Asp-Pro) rather then five (Met-Ser-Glu-Asp-Pro) preceding Asp63. The insert was amplified with pFU Ultra II (Agilent Technologies) using a standard protocol employing forward (5’-ATG TTC ATA TGT CGT ACT ACC ATC ACC AT -3’) and reverse primers (5’-TTG GAA TTC TCA CTT AGC CTG CTG GTA G -3’), then cut with NdeI/EcoRI, and ligated into similarly cut pET-22b(+) (Life Technologies), to give a plasmid hereafter referred to as pDG22b. The plasmid integrity was confirmed by DNA sequencing.

Madrona Y., Waddling C.A, & Ortiz de Montellano P.R. (2016). Crystal Structures of the CO- and NO-Bound DosS GAF-A Domain and Implications for DosS Signaling in Mycobacterium tuberculosis. Archives of biochemistry and biophysics, 612, 1-8.

+ Open protocol

+ Expand

Cloning and Expression of Arabidopsis NF-YA Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full-length coding region of each NF-YA gene (NF-YA1 to NF-YA9) was amplified from cDNA by PCR using Pfu Ultra II (cat#600670, Agilent Technologies) and ligated into the Gateway® entry vector pENTR/D-TOPO (cat#45-0218, Invitrogen). All constructs were sequenced and found to be identical to sequences at The Arabidopsis Information Resource (http://www.arabidopsis.org (Huala et al. 2001 (link))). NF-YA10 cDNA in pDONR221 was obtained from ATOME1 ORFEOME library (stock#51B10, CNRGV). All NF-YA cDNA clones were introduced to the plant expression destination vector pEarlyGate102 (stock#CD3-684, ABRC) (Earley et al. 2006 ) using the Gateway® LR Clonase II™ reaction kit (cat#56485, Invitrogen). The 35S cauliflower mosaic virus promoter (p35S) (Kay et al. 1987 (link)) was driving the expression of each gene. Transgenic plants were generated using agrobacterium-mediated floral dipping described in previous studies (Clough and Bent 1998 (link)). At least two independent homozygous or hemizygous transgenic lines were examined for each NF-YA (Table S1).

Siriwardana C.L., Kumimoto R.W., Jones D.S, & Holt BF I.I.I. (2014). Gene Family Analysis of the Arabidopsis NF-YA Transcription Factors Reveals Opposing Abscisic Acid Responses During Seed Germination. Plant Molecular Biology Reporter, 32(5), 971-986.

+ Open protocol

+ Expand

Generating Deletion Mutants of TFG

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

As previously described [18 (link)], the full-length TFG was generated by PCR amplification using pcDNA3.1/NT-GFP-TOPO TA Expression Kits (Invitrogen, Thermo Fisher Scientific, Waltham, MA). The deletion-mutations were generated by PCR amplification based on template pcDNA3.1/NT-GFP-TOPO TFG plasmid using pfuUltra II (Agilent Technologies, Santa Clara, CA). The sequences of primers used to generate those mutants were as following: del1_primer: GGATCTAAGTGGGAAGCTAAGACCCCTTGAATCAAGTC; del2_primer: TTTGTTAATGGCCAGCCACAAACTTCTCAGCCTACT; del3_primer: ACAAACTTACACTGCCCAAACTGGACCTGGTTATCGATAA.

Ma C., Hokutan K., Shen Y., Nepal M., Kim J.H., Zhang J, & Fei P. (2020). TFG-maintaining stability of overlooked FANCD2 confers early DNA-damage response. Aging (Albany NY), 12(20), 20268-20284.

+ Open protocol

+ Expand

Molecular Cloning Techniques in Bacterial Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

The oligonucleotides used in this study are listed in Table 3. DNA ligations, restriction endonuclease digestions, and agarose gel electrophoresis were performed using standard molecular biology techniques (81 ), with Gibson assembly undertaken according to published protocols (82 (link)). All restriction enzymes, T4 DNA ligase, and Gibson master mix were used as recommended by the manufacturer (New England Biolabs). E. coli PIR2 and DH5α cells were transformed using heat shock-based transformation. PCR amplifications were carried out using either Phusion DNA (Thermo Fisher Scientific) or Pfu Ultra II (Agilent) polymerases were used according to the manufacturer’s recommendations with the addition of 2.5% dimethyl sulfoxide (DMSO) for the amplification of B. cenocepacia DNA due to its high GC content. DNA isolation, PCR recoveries, and restriction digest purifications were performed using the genomic DNA cleanup kit (Zmyo Research, CA) or Wizard SV gel and PCR cleanup system (Promega). Colony and screening PCRs were performed using GoTaq Taq polymerase (Qiagen) supplemented with 10% DMSO when screening B. cenocepacia. All constructs in Table 2 were confirmed by Sanger sequencing undertaken at the Australian Genome Research Facility (Melbourne, Australia).

Oppy C.C., Jebeli L., Kuba M., Oates C.V., Strugnell R., Edgington-Mitchell L.E., Valvano M.A., Hartland E.L., Newton H.J, & Scott N.E. (2019). Loss of O-Linked Protein Glycosylation in Burkholderia cenocepacia Impairs Biofilm Formation and Siderophore Activity and Alters Transcriptional Regulators. mSphere, 4(6), e00660-19.

+ Open protocol

+ Expand

COUP-TFII_V1 Protein Expression via EGFP Tagging

Check if the same lab product or an alternative is used in the 5 most similar protocols

To produce the N-terminal enhanced green fluorescence protein (EGFP)-tagged COUP-TFII_V1 a 1.5 Kb EcoRI/XhoI fragment of the COUP-TFII_V1 cDNA was amplified from the plasmid pCR3.1-COUP-TFII by PCR with PFU Ultra II (Agilent Technologies) using the following primers: Forward, 5′-C AT GAA TTC GGC AAT GGT AG-3′ and reverse, 5′-TAG AAG GCA CAG TCG AGG-3′. Thermocycling conditions were as per the manufacturer's instructions with annealing at 54°C for 30 sec and extension at 72°C for 30 sec (×35 cycles); reaction mixtures were prepared as per the manufacturer's protocol. After digestion with EcoRI and XhoI enzymes (New England Biolabs, Inc.) and gel purification of the PCR product, the COUP-TFII cDNA was ligated in the EcoRI/SalI sites of pEGFP-C1 (GenBank accession no. U55763; cat. no. 6084-1; Clontech). The absence of errors due to PCR amplification was confirmed by standard Sanger DNA sequencing. The pCR3.1-COUP-TFII plasmid was a kind gift of Professor M. Vasseur-Cognet [INSERM, U1016; Department of Endocrinology, Metabolism and Cancer, Cochin Institute, CNRS (UMR 8104), Paris, France].

Polvani S., Pepe S., Tempesti S., Tarocchi M., Marroncini G., Bencini L., Ceni E., Mello T., Picariello L., Simeone I., Grappone C., Dragoni G., Antonuzzo L., Giommoni E., Milani S, & Galli A. (2022). Isoforms of the orphan nuclear receptor COUP-TFII differentially modulate pancreatic cancer progression. International Journal of Oncology, 60(5), 55.

+ Open protocol

+ Expand

Codon-Optimized Zebrafish CFTR Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Codon optimized zebrafish CFTR (zCFTR) was provided by Dr. Jue Chen (Rockefeller University). The native form of zebrafish CFTR (nzCFTR) was a gift from Dr. Michel Bagnat‘s lab at Duke University. Site-directed mutagenesis was done by PCR mutagenesis using the Pfu Ultra II (Agilent Technologies). All constructs were confirmed by DNA sequencing (DNA core; University of Missouri-Columbia) and amplified using Invitrogen Plasmid Miniprep Kit. Chinese hamster ovary (CHO) cell line from American Type Culture Collection, Manassas, VA, USA) was grown at 37°C and 95% O₂−5% CO₂ in Dulbecco’s modified Eagle’s medium (Life Technologies, Inc., Rockville, MD, USA) containing 10% fetal bovine serum (Harlan Biosciences, Madison, WI, USA). The cDNA constructs of CFTR were co-transfected with peGFP-C3 (Takara Bio Inc.) encoding the green fluorescent protein using PolyFect transfection reagent (QIAGEN) into CHO cells. The transfected cells were transferred into 35 mm tissue culture dishes containing one layer of sterilized glass chips for cells to grow on. The transfected cells were incubated at 27°C for 2–7 days before experiments were performed.

Zhang J., Yu Y.C., Yeh J.T, & Hwang T.C. (2018). Functional characterization reveals that zebrafish CFTR prefers to occupy closed channel conformations. PLoS ONE, 13(12), e0209862.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!