The cDNA of the target genes was synthesized using the Easyscript® One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (Beijing TransGen Biotech, Beijing, China). In a 20 µL reaction system, 1 µg total RNA, 10 µL 2 × ES reaction mixture, 1 µL Oligo(dT)18 primer, 1 µL Easyscript® RT/RI Enzy Mix, 1 µL gDNA remover, and variable RNase-free water were mixed. The mixture was incubated at 42 °C for 30 min, followed by 85 °C for 5 s. For miRNA cDNA synthesis, a miRNA-specific stem-loop RT primer was used. The reaction was incubated at 16 °C for 30 min, followed by 30 °C for 30 s, 42 °C for 30 s, and 50 °C for 20 s for 60 cycles. Finally, the reaction was stopped at 85 °C for 5 s.
Mircute plant mirna isolation kit
The MiRcute Plant miRNA Isolation Kit is a laboratory equipment product designed to isolate and purify microRNA (miRNA) from plant samples. The kit utilizes a specialized column-based method to extract miRNA from various plant tissues.
Lab products found in correlation
5 protocols using mircute plant mirna isolation kit
Cotton Total RNA Extraction and cDNA Synthesis
The cDNA of the target genes was synthesized using the Easyscript® One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (Beijing TransGen Biotech, Beijing, China). In a 20 µL reaction system, 1 µg total RNA, 10 µL 2 × ES reaction mixture, 1 µL Oligo(dT)18 primer, 1 µL Easyscript® RT/RI Enzy Mix, 1 µL gDNA remover, and variable RNase-free water were mixed. The mixture was incubated at 42 °C for 30 min, followed by 85 °C for 5 s. For miRNA cDNA synthesis, a miRNA-specific stem-loop RT primer was used. The reaction was incubated at 16 °C for 30 min, followed by 30 °C for 30 s, 42 °C for 30 s, and 50 °C for 20 s for 60 cycles. Finally, the reaction was stopped at 85 °C for 5 s.
Quantitative Analysis of miRNAs and Target Genes in 'Feng Dan' Leaves
RNAs of ‘Feng Dan’ leaves were extracted using a RNAprep Pure Plant Plus Kit (Polysaccharides & Polyphenolics-rich) (TIANGEN), and then cDNAs were synthesized using a PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (TakaRa, Shiga, Japan). A Tubulin-β gene was used as reference [30 ]. A TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (TakaRa) kit was used for qRT-PCR.
Three replicates were included for each sample respectively. Primers used for qRT-PCR are listed in Appendix
Primers for qRT-PCR.
Primers | Sequences (5′-3′) |
---|---|
ptc-miR396g-5p (Forward) | CGGTTCCACGGCTTTCTTGACT |
UBQ (Forward) | TACCCAAACAGCCCTCCAAC |
psu.T.00022975 (Forward) | GGCACCAAGGTCAGCAACTA |
psu.T.00022975 (Reverse) | TGGAATGACGCATAGGAGGA |
Tubulin-β (Forward) | TTGAGAACGCCGACGAGTGT |
Tubulin-β (Reverse) | ACCAGGAAAACGAAGGCAGC |
Isolation and Reverse Transcription of Plant miRNAs
miRNA Extraction and Synthesis Protocol
Quantifying Plant and Fungal miRNA Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!