Monoclonal anti na k atpase antibody

Quantitative real-time PCR (qRT-PCR) was employed to detect PKD1 expression in WT and PKD1^+/- pigs. RNA was extracted from ear-biopsies and kidneys of the cloned pigs by RNeasy (Qiagen) and RNase-free DNase (Qiagen). The primers for PKD1 3' part were 3'-Q-F (CATGTGGCTCCTCTCAAGCA) and 3'-Q-R (GCTTCCAGCAGGACCTTGAGT) targeting exons 36 & 37, for 5' part were 5'-Q-F (ACGTCGGGCTCCTAGAGAA) and 5'-Q-R (TTCCCGCTCAGGTTTATTTC) targeting exons 2 & 3, while those for the internal control, GAPDH, were GAPDH-F (ATCACCATCTTCCAGGAGCGA) and GADPH-R (AGCCTTCTCCATGGTCGTGAA). One microgram of RNA from these tissues was reverse-transcribed into cDNA using oligo dT or random primer in a volume of 25 μL. Then, qRT-PCR reactions were performed in triplicate.
Membrane protein was extracted from the kidneys using the Membrane and Cytosol Protein Extraction Kit (Beyotime, Nantong, China). Eighty micrograms of membrane protein per lane was separated, transferred, and blotted according to a previously established protocol 18 (link). The antibodies used to detect PC1 were 7e12 (gift from Dr. Christopher Ward) with 1:500 dilution. For internal control, the mouse monoclonal anti-Na⁺, K⁺-ATPase antibody (Abcam) was utilized at a 1:1,000 dilution.