128° Y-Cut X-propagating lithium niobate (LiNbO3) substrate was obtained from Red Optronics. Square borosilicate hollow glass tubes with an inner diameter and outer diameter of 100 and 200 μm, respectively, were obtained from VitroCom. TEOS, ammonium hydroxide (NH3•H2O, 25%), 200-proof ethanol, N,N’-carbonyldiimidazole (CDI), streptavidin, dimethyl sulfoxide (DMSO), Rhodamine B, potassium permanganate (KMnO4), 1-butanol, zinc nitrate (Zn(NO3)2) hexahydrate, zinc acetate (Zn(OAc)2) dihydrate, hexamethylenetetramine (HMTA), sodium hydroxide (NaOH), 1H,1H,2H,2H-Perfluorooctyl trichlorosilane (PFOCTS), silver nitrate (AgNO3), and sodium borohydride (NaBH4) were purchased from Sigma-Aldrich. Polydimethylsiloxane (PDMS, Sylgard 184 kit) was obtained from Dow Corning. Biotinylated CD63 aptamer with a sequence of 32 bases (CACCCCACCTCGCTCCCGTGACACTAATGCTA) was provided by Integrated DNA Technologies. Acoustic transducer was obtained from PUI Audio (AB2720B-LW100-R). Fluorescent polystyrene beads (1 μm) were provided from Bangs Laboratory. ExoStd human urine fluorescent exosome and ExoStd human urine exosome standard samples were purchased from BioVision. Human plasma from a healthy donor was bought from ZenBio.
Zinc nitrate zn no3 2 hexahydrate
Manufactured by Merck Group
Zinc nitrate (Zn(NO3)2) hexahydrate is a crystalline compound that is commonly used in various laboratory applications. It is a salt formed by the combination of zinc and nitric acid, and it typically exists in the form of hexahydrate, meaning it contains six water molecules in its crystal structure. This compound is soluble in water and has a variety of applications in the scientific and industrial fields.
Automatically generated - may contain errors
Lab products found in correlation
1 butanol, by Merck Group (1 mentions)
Sodium borohydride nabh4, by Merck Group (1 mentions)
Potassium permanganate kmno4, by Merck Group (1 mentions)
Horseradish peroxidase hrp, by Merck Group (1 mentions)
Albumin from chicken egg white, by Merck Group (1 mentions)
Delrin, by McMaster-Carr (1 mentions)
2 protocols using zinc nitrate zn no3 2 hexahydrate
1
Exosome Capture and Characterization
2
Protein Encapsulation in Polymeric Micelles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The top disk and bottom receiver were manufactured from stainless steel, and the mixing geometry was made of Delrin® (McMaster-Carr, Robbinsville, NJ). The O-ring was FKM, 35.5 mm × 1.5 mm (C.E. Conover, Bensalem, PA). The syringe fittings were ¼″ luer fittings (P-604; Idex, Oak Harbor, WA). The outlet fitting was ¼″ VacuTight (P-942x; Idex). Albumin from chicken egg white (ovalbumin [OVA], lyophilized powder, >98%), horseradish peroxidase (HRP) (highly stabilized, essentially salt free), and zinc nitrate (Zn(NO3)2) hexahydrate (reagent grade, 98%) were purchased from Sigma-Aldrich (St. Louis, MO). Dextran T20 was purchased from Pharmacia Fine Chemicals (Uppsala, Sweden). Optima® chloroform (CHCl3), HPLC grade tetrahydrofuran (THF, unstabilized), and HPLC grade DMSO were purchased from Fisher Scientific. Poly(styrene)-block-poly(acrylic acid) (PS-b-PAA, 4.8k-b-5k, polydispersity index [PDI] 1.4), PS (1.8k, PDI 1.08), and PS-b-PEG (1.6k-b-5k, PDI 1.10) were purchased from Polymer Source (Dorval, Quebec). All reagents were used as received. Deionized water was treated to a resistivity of 17.8 mΩ-cm or greater (NANOpure Diamond; Barnstead International, Dubuque, IA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!