The largest database of trusted experimental protocols

R0017

Manufactured by Abnova

R0017 is a laboratory equipment product. It is designed for use in scientific research and analysis. The core function of R0017 is to [description not available].

Automatically generated - may contain errors

2 protocols using r0017

1

Autophagy Modulation Impacts HRV-16 Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols
NHTE cells at passage 2 were seeded at 2 × 105 cells/well onto collagen-coated 12-well cell culture plates. ATG5 chimera siRNA (ATG5 siRNA, H00009474-R01, Abnova, Taipei, Taiwan) or Naito1 chimera RNAi (control siRNA, R0017, Abnova) was transfected into cells at 60–70% confluence using siRNA transfection reagents (Santa Cruz Biotechnology Inc., Santa Cruz, CA) according to the manufacturer's instructions. Twenty-four hours after siRNA transfection, cells were treated with or without 100 mM trehalose for 48 h to induce autophagy. Thereafter, cells were infected with HRV-16 at 104 TCID50/well or sterile PBS (control) as described above. Cells were processed to examine ATG5 knockdown by Western blot, IFN-λ1 mRNA expression and HRV RNA levels by quantitative RT-PCR after 6 h of HRV-16 infection when the anti-viral response is expected to peak.
+ Open protocol
+ Expand
2

Knockdown of DNA repair genes in mammalian cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Control siRNA (no target in mammalian cells, R0017) was purchased from Abnova, Walnut, CA. siRNA against atr (5′AACGAGACTTCTGCGGATTGCAGCA3′) and msh2 (5′AATCTGCAGAGTGTTGTGCTTAGTA3′) were supplied by Invitrogen (Stealth RNAi siRNA duplex). SiRNA against xrcc1 (M-009394-01-0005), ape1 (M-010237-00-0005), mlh1 (J-003906-10-0005), pcna (D-003289-10-0005, M-003289-02-0005 for rescue), apobec3b (J-017322-08-0005), apobec3c (J-013711-08-0002) and apobec3f (J-019039-17-0005) were purchased from Dharmacon RNAi Technologies / GE Healthcare, Fairfield, CT.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!