Pgl3 firefly luciferase control vector
The PGL3 firefly luciferase control vector is a plasmid that contains the firefly luciferase gene under the control of a promoter. It is used as a positive control in luciferase reporter assays.
Lab products found in correlation
7 protocols using pgl3 firefly luciferase control vector
Regulation of Cp110 by miR-34/449
Regulation of Cp110 by miR-34/449
Cloning Cyclin D 3' UTR Constructs
3 0 UTR-Cyc D1 forward, AATTTCTAGAGGGGGCGTAGCATCATAGTA 3 0 UTR-Cyc D1 reverse, AATTTCTAGAGTGCAACCAGAAATGCACAG The 3 0 UTR regions of the Cyc D3, including binding sites for miR138 were amplified by PCR from genomic DNA by using the following primers:
3 0 UTR-Cyc D3 forward, AATTTCTAGAACATGGCCAGTCAGTTCCTC 3 0 UTR-Cyc D3 reverse, AATTTCTAGACTGAAGGACCCAGATCCAAA The amplified fragments were cloned into pGL3-control firefly luciferase vector (Promega, Madison, WI) at the XbaI site immediately downstream from the stop codon of luciferase in sense orientation. For the generation of 3 0 UTR constructs mutated in the miR binding sites, the 3 0 UTR amplified fragments were cloned in antisense orientation.
Validating miR-29b Regulation of AKT2/3
Luciferase Assay for BRCA2 Promoter Silencer
DNMT3A and DNMT3B 3' UTR Luciferase Assay
SIRT1 3'UTR Luciferase Assay
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!