Abi 3730xl dna analyzer

Manufactured by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Japan, Canada, Cameroon

The ABI 3730xl DNA Analyzer is a high-throughput capillary electrophoresis instrument designed for DNA sequencing. It features 96 capillaries and can generate up to 192 sequencing reads per run. The instrument utilizes laser-induced fluorescence detection to analyze DNA fragments and produce sequence data.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

3730xl DNA Analyzer (667 citations) ABI 3730XL (295 citations) ABI PRISM 3730XL DNA Analyzer (156 citations) ABI 3730XL analyzer (30 citations) 3730XL Analyzer (8 citations) ABI 3730xl Automated DNA Analyzer (5 citations) ABI 3730XL 96-capillary DNA analyzer (5 citations) ABI 3730xl DNA analyzer platform (4 citations) ABI 3730XL DNA Genetic Analyzer (4 citations) ABI 3730xl DNA analyzer system (2 citations)

591 protocols using abi 3730xl dna analyzer

Eranthis Chloroplast Microsatellite Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

All of the 935 individuals of the four Eranthis species were genotyped at 12 chloroplast microsatellite loci (Ebp01, Ebp40, Ebp27, Ebp31, Ebp25, Ebp12, Ebp10, Ebp06, Ebp38, Ebp11, Ebp28, Ebp32) which were randomly selected from the 24 cpSSR loci isolated by Oh and Oh (2017). The PCR procedure was the same as that of Oh and Oh (2017), and the length of PCR products was measured using the ABI3730xl DNA Analyzer (Applied Biosystems) and GeneMapper v. 3.7 (Applied Biosystems).
In addition, one individual from each population of the four focal Eranthis species (giving a total of 33 individuals) and five outgroup species, were sequenced at two chloroplast noncoding regions, rpl16 intron and petL‐psbE (Shaw et al., 2005; Shaw, Lickey, Schilling, & Small, 2007). Sequencing was conducted in both directions with ABI3730xl DNA Analyzer (Applied Biosystems), and the consensus sequences were created with Sequencher 4.8 (Gene Codes Corp., Ann Arbor, MI, USA).

Oh A, & Oh B. (2019). The speciation history of northern‐ and southern‐sourced Eranthis (Ranunculaceae) species on the Korean peninsula and surrounding areas. Ecology and Evolution, 9(5), 2907-2919.

+ Open protocol

+ Expand

Molecular Characterization of KEAP1 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted and used to synthesize the first chain cDNA according to the procedure described in the real-time PCR analysis description. cDNA was used as a template to synthesize six segments of the KEAP1 gene using the following cycling conditions: initial denaturing step at 94 °C for 5 min followed by 30 cycles at 94 °C for 40 s, 60 °C for 40 s, and 72 °C for 55 s. Products were separated on 1 % agarose gels, and bands were visualized with ethidium bromide. The products were sequenced using the ABI3730 XL DNA Analyzer (Applied Biosystem Japan, Tokyo, Japan) and analyzed with Chromas 2.4.3 software. Primers used to amplify the KEAP1 gene fragments were:

Fragment 1, forward AGAGGTGGTGGTGTTGCTTAT

Reverse TGGAGATGGAGGCCGTGTA

Fragment 2, forward CAGGTCAAGTACCAGGATG

Reverse GATGAGGGTCACCAGTTG

Fragment 3, forward ATCGGCATCGCCAACTTC

Reverse AGGTAGCTGAGCGACTGT

Fragment 4, forward CAGAAGTGCGAGATCCTG

Reverse GCTCTGGCTCATACCTCT

Fragment 5, forward GCCCTGGACTGTTACAAC

Reverse GTCTCTGTTTCCACATCGTA

Fragment 6, forward GCTGTCCTCAATCGTCTC

Reverse AGTTCTGCTGGTCAATCTG

NRF2 exon2, forward TCGTGATGGACTTGGAGCTG

Reverse AGCATCTGATTTGGGAATGTG

Sections were spliced together after manual inspection and compared with the reference sequence with BLAST to identify potential mutations.

Tian Y., Wu K., Liu Q., Han N., Zhang L., Chu Q, & Chen Y. (2016). Modification of platinum sensitivity by KEAP1/NRF2 signals in non-small cell lung cancer. Journal of Hematology & Oncology, 9(1), 83.

+ Open protocol

+ Expand

Pharmacokinetics and Genotyping of Busulfan

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blood samples for PK analysis and genotyping were withdrawn from central venous lines, in heparinized glass tubes, pre-infusion, 0.5, 1, 2, 2.5, 4 and 6 hours after the first infusion. Plasma concentrations of Bu were determined using a high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS).1 (link) The lower limit of quantitation was 10 ng/mL and the range of quantitation was from 10 to 10,000 ng/mL.
Pretransplant genomic DNA was isolated and extracted from whole blood prior to the first Bu infusion. Improve potassium iodide methods was applied for DNA extraction from whole blood. Ammonium chloride was used to destroy red blood cells, and potassium iodide was used to destroy white blood cells and their nuclear membranes for a short time. Then, proteins, lipids and residual cell debris are precipitated by chloroform/isopropanol. Finally, DNA is precipitated by isopropanol, and was washed by ethanol. The extracted genomic DNA was dissolved with TE. After confirming the DNA concentration and purity, PCR amplification and purification of PCR product were performed. GST genotypes of patients, GSTA1 (rs3957356 and rs3957357, which defines haplotype *A and *B) and GSTM1 (rs3754446), were detected with the ABI 3730XL DNA Analyzer (Applied Biosystem).26 (link)

Supporting Information Table 2

displays the primer sets and Tm used for the genotyping assays.

Yuan J., Sun N., Feng X., He H., Mei D., Zhu G, & Zhao L. (2021). Optimization of Busulfan Dosing Regimen in Pediatric Patients Using a Population Pharmacokinetic Model Incorporating GST Mutations. Pharmacogenomics and Personalized Medicine, 14, 253-268.

+ Open protocol

+ Expand

Genetic Characterization of Scleractinian-Associated Hydroids

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total genomic DNA of 63 ethanol-fixed Zanclea samples from 13 scleractinian genera was extracted following a protocol modified from Zietara et al. [58 ]. Three different molecular markers were amplified: (1) a ~300 bp portion of the nuclear 28S ribosomal DNA gene (28S), (2) a ~400 bp portion of the mitochondrial 16S ribosomal RNA gene (16S), and (3) a ~700 bp portion of the mitochondrial cytochrome oxidase subunit I gene (COI). The first two regions of DNA have been extensively used to infer phylogenetic relationships among hydroids in numerous previous molecular studies [26 (link), 28 , 44 , 45 , 59 –61 ]. We also selected the barcoding region of COI gene because it turned out to be useful for species delimitation in Hydrozoa [40 (link), 62 (link)]. 16S and 28S genes were amplified using hydroid-specific primers and the protocols proposed by Fontana et al. [26 (link)]. The barcoding region of COI gene was amplified using universal primers LCO1490 and HCO2198 and the protocol proposed by Folmer et al. [63 (link)]. All PCR products were purified and directly sequenced in forward and reverse directions using an ABI 3730xl DNA Analyzer (Applied Biosystem, Foster City, CA, USA). The sequences obtained in this study were deposited with the EMBL, and the accession numbers are listed in Table 1.

Montano S., Maggioni D., Arrigoni R., Seveso D., Puce S, & Galli P. (2015). The Hidden Diversity of Zanclea Associated with Scleractinians Revealed by Molecular Data. PLoS ONE, 10(7), e0133084.

+ Open protocol

+ Expand

Molecular Characterization of Streptomyces by 16S rRNA Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Molecular characterization of Streptomyces was carried out by 16S rRNA analysis. The cells from the biomass were harvested by centrifugation, washed, and re-suspended in TE buffer (10 mM Tris/HCl, 1 mM EDTA; pH 8.0). Genomic DNA was extracted by a standard protocol and the PCR amplification was conducted in Eppendorf Master Cycle gradient AG22331 (Model No. 5331), using appropriate forward primer 27F (5' AGA GTT TGA TCC TGG CTC AG 3') and reverse primer 1525R (5' AGA AAG GAG GTG ATC CAG CC 3') in the E. coli numbering system [8 (link), 9 ]. The amplified products were sequenced in Applied Biosystem Sequencer (ABI 3730XL DNA Analyzer) with appropriate primers.
This 16S rRNA gene sequence was used for phylogenetic analysis. The 16S rRNA gene sequence related taxa were acquired from the GenBank database and the primer was designed using the Primer 3 software. Multiple sequence alignment was conducted using the Clustal W program and the phylogenetic tree was constructed using the neighbor-joining method [10 (link), 11 (link)] using the MEGA7 software (https://www.megasoftware.net/) and phylogeny program (http://www.phylogeny.fr/). The evolutionary distances for the neighbor-joining and maximum likelihood tree were calculated by Kimura’s two-parameters method. The topologies of each tree have been evaluated using bootstrap resampling methods based on 1,000 replications.

Ghosh M., Gera M., Singh J., Prasad R, & Pulicherla K.K. (2020). A Comprehensive Investigation of Potential Novel Marine Psychrotolerant Actinomycetes sp. Isolated from the Bay-of-Bengal. Current Genomics, 21(4), 271-282.

+ Open protocol

+ Expand

Enterovirus Serotype Identification via RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The nested RT-PCR yielded about a 389bp amplicon. The final PCR products were subjected to sequencing in both directions using the ABI 3730 XL DNA Analyzer (Applied Biosystem Inc., Foster City, CA). Nucleotide sequences of 5’-UTR were checked by the BLAST search in the NCBI database to identify the enterovirus serotype with the highest identity. Obtained sequences were assembled using SeqMan software (version7.1.0). Phylogenetic tree was constructed by neighbor-joining method with 1000 bootstrap replications using MEGA6.0. Reference sequences representing EV71, CVA (2, 4, 6, 10, 12, 16), CVB4, Echo (3, 9, 25) and HEV-C were downloaded from NCBI database and selected for phylogenetic analysis.

Guan H., Wang J., Wang C., Yang M., Liu L., Yang G, & Ma X. (2015). Etiology of Multiple Non-EV71 and Non-CVA16 Enteroviruses Associated with Hand, Foot and Mouth Disease in Jinan, China, 2009—June 2013. PLoS ONE, 10(11), e0142733.

+ Open protocol

+ Expand

Enterovirus Typing via VP1 Gene Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was extracted from the clinical specimens using a QIAamp Mini Viral RNA Extraction Kit (Qiagen, Germany). EV VP1 gene (350–400 bp) was amplified as described in detail previously [11 (link), 15 (link)]. The amplified DNA was sequenced using the ABI 3730 XL DNA Analyzer (Applied Biosystem Inc., Foster City, CA). Nucleotide sequences of the partial VP1 gene were analyzed using the BLAST search in the GenBank database to find the enterovirus serotype with the highest identity. Alignment of the nucleotide sequences and phylogenetic analysis were conducted as described in detail previously [11 (link), 15 (link)]. Nucleotide sequences analyzed in this study have been submitted to GenBank (accession numbers KM816412-KM816579).

Chung W.Y., Chiang P.S., Luo S.T., Lin T.Y., Tsao K.C, & Lee M.S. (2016). A Molecular Approach Applied to Enteroviruses Surveillance in Northern Taiwan, 2008-2012. PLoS ONE, 11(12), e0167532.

+ Open protocol

+ Expand

Microsatellite Genotyping for Seahorse Population Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

A novel set of 13 microsatellites from those previously reported in the genus Hippocampus was selected for population analysis following technical and polymorphism criteria (Table 2; [37 –39 ]). Two multiplex PCR using multiple primer sets were assayed for amplifying and genotyping these microsatellite loci. A first set of six loci useful for parentage analysis in H. guttulatus was amplified in a single PCR for all wild seahorses and offspring (Hgu-USC5, Hgu-USC6, Hgu-USC7, Hgu-USC8, Hgut4, Hgut6) following López et al. [35 ]. A second PCR multiplex with the remaining seven loci was amplified for wild seahorses in a volume of 10 μL with 1X Qiagen Multiplex PCR Master Mix, 50 ng of DNA template, and 0.08, 0.10, 0.10, 0.08, 0.15, 0.15, 0.10 μM of each primer for Hgu-USC2, Hgu-USC4, Hgu-USC9, Hgu-USC12, Hgu-USC13, Hcaμ25, Hcaμ36, respectively, using NED, 6-FAM, VIC, VIC, 6-FAM, PET, PET as 5’ fluorescent label for their respective forward primer. PCR conditions consisted of an initial denaturation at 95°C for 15 min, followed by 25 cycles at 94°C for 30 s, 57°C for 90 s and 72°C for 60 s, and a final extension at 60°C for 30 min. PCR products were run on an ABI 3730xl DNA Analyzer (Applied Biosystem), using GeneMapper v4.0 (Applied Biosystems) for genotyping.

López A., Vera M., Planas M, & Bouza C. (2015). Conservation Genetics of Threatened Hippocampus guttulatus in Vulnerable Habitats in NW Spain: Temporal and Spatial Stability of Wild Populations with Flexible Polygamous Mating System in Captivity. PLoS ONE, 10(2), e0117538.

+ Open protocol

+ Expand

Sanger Sequencing and Bioinformatic Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The amplicons were sequenced using an ABI 3730XL DNA Analyzer (Applied Biosystem Inc., Foster City, CA) using Sanger (dideoxy chain termination) technology. Nucleotide sequences were analyzed using Chromas v.2.6.6 (http://www.technelysium.com.au) and BlastN and BlastX BlastNetwork algorithms available in the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The nucleotide sequences were translated into amino acids and protein coding sequences were annotated via EMBOSS Transeq tool (https://www.ebi.ac.uk/Tools/st/emboss_transeq/).

Yousefi Nojookambari N., Eslami G., Sadredinamin M., Vaezjalali M., Nikmanesh B., Dehbanipour R., Yazdansetad S, & Ghalavand Z. (2024). Sub-minimum inhibitory concentrations (sub-MICs) of colistin on Acinetobacter baumannii biofilm formation potency, adherence, and invasion to epithelial host cells: an experimental study in an Iranian children’s referral hospital. Microbiology Spectrum, 12(2), e02523-23.

+ Open protocol

+ Expand

Identification of Transposon Insertion Sites

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from each morphology mutant using the Wizard Genomic DNA purification Kit (Promega), and the site of the transposon insertion was identified by the DNA Walking SpeedUp Premix Kit (Seegene Inc, Seoul, Korea) using genomic DNA as template and TS1 and TS2 provided in the kit as primers for Polymerase Chain Reactions (PCRs). All the PCR primers used in this work are listed in S2 Table. The cycling conditions were as described in Deng et al. (2013) [17 (link)]. The resulting PCR fragments were purified using the NuceloSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Bethlehem, PA), and sequenced using an ABI 3730XL DNA Analyzer (Life Technologies, Carlsbad, CA) at Penn State’s Genomics Core Facility. Sequences were analyzed with the Lasergene (DNAstar, Inc. Madison, WI) software package. The nucleotide sequence of each resulting DNA fragment was compared with the genome sequence of G. hansenii ATCC23769 (GenBank accession number NZ_CM000920.1) [20 (link)] using BLASTN and BLASTtx (blast.ncbi.nlm.nil.gov).

Deng Y., Nagachar N., Fang L., Luan X., Catchmark J.M., Tien M, & Kao T.H. (2015). Isolation and Characterization of Two Cellulose Morphology Mutants of Gluconacetobacter hansenii ATCC23769 Producing Cellulose with Lower Crystallinity. PLoS ONE, 10(3), e0119504.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!