Log In Sign up
The largest database of trusted experimental protocols

H3393

Manufactured by Merck Group
Visit Supplier
Sourced in United States, Germany

H3393 is a laboratory equipment product. It is a piece of equipment designed for use in research and scientific applications. The core function of H3393 is to perform specific tasks or measurements related to laboratory experimentation and analysis.

Automatically generated - may contain errors

Lab products found in correlation

Mak115, by Merck Group (2 mentions) Matrigel, by Corning (2 mentions) Ab108907, by Abcam (2 mentions) Envision 2105 multimode plate reader, by PerkinElmer (2 mentions) Prism v8, by GraphPad (2 mentions) Vacutainer serum collection tube, by BD (2 mentions) Enoxaparin, by Merck Group (1 mentions) Nano itc instrument, by TA Instruments (1 mentions) Anti fgf2, by R&D Systems (1 mentions) Blitz system, by Molecular Devices (1 mentions) Mts reagent, by Promega (1 mentions) K 113, by Merck Group (1 mentions) Hy 13653, by MedChemExpress (1 mentions) Fitc conjugated goat anti mouse igg ab6785, by Abcam (1 mentions) Vascular endothelial growth factor (vegf), by Thermo Fisher Scientific (1 mentions) Calcitriol, by Merck Group (1 mentions) Endothelial cell growth supplement (ecgs), by BD (1 mentions) Penicillin streptomycin, by Merck Group (1 mentions) Dynabeads protein a, by Thermo Fisher Scientific (1 mentions) A9647, by Merck Group (1 mentions)

25 protocols using h3393

1

TgPDCD5 Heparin Binding Kinetics

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative estimations of heparin-binding
affinities for some proteins using ITC have been reported.49 (link)−51 (link) To investigate the interaction between TgPDCD5 and heparin sulfate
(H3393, Sigma-Aldrich) or Enoxaparin (E0180000, Sigma-Aldrich), ITC
was performed using a Nano ITC instrument (TA Instruments). Aliquots
of 4 μL of 3 mM TgPDCD5 were injected into 0.12 mM heparin sulfate
or Enoxaparin in 25 mM phosphate buffer at pH 4.5 with 100 mM NaCl
while maintaining a temperature of 37 °C with 250 rpm stirring.
Background heat from the protein to buffer titrations was subtracted.
The thermal parameters (enthalpy ΔH and entropy
ΔS), stoichiometry of the binding (n), and dissociation constant (Kd) were derived by fitting the data to an independent binding model
using Launch NanoAnalyze v2.3.6 software.
Lin G.M., Yu T.A., Chang C.F, & Hsu C.H. (2024). Proline Isomerization and Molten Globular Property of TgPDCD5 Secreted from Toxoplasma gondii Confers Its Regulation of Heparin Sulfate Binding. JACS Au, 4(5), 1763-1774.
+ Open protocol
+ Expand
2

Binding and Signaling of MPS IIIA GAGs and FGF2

Check if the same lab product or an alternative is used in the 5 most similar protocols
The binding of MPS IIIA GAGs to FGF2 was analysed in the Blitz ® system (ForteBio) using protein G sensors and operated with PBS, pH 7.4 containing 1% (v/v) Tween-20. Sensors were equilibrated in buffer for 30 s and then exposed to anti-FGF2 antibody (1:1000, rabbit polyclonal anti-FGF2, R&D Systems) for 120 s followed by rinsing in buffer for 30 s. Sensors were exposed to 50 μg/mL FGF2 for 120 s followed by rinsing in buffer for 30 s and then exposed to MPS IIIA GAGs or heparin (1–20 μg/mL; Sigma H3393) for 120 s and rinsed with buffer for 30 s. The affinity, KD, between FGF2 and either MPS IIIA GAGs or heparin was determined assuming 1:1 binding. Signalling via the fibroblast growth factor receptor (FGFR) was determined using the BaF32 cell proliferation assay which relies on the formation of an active ternary complex between GAG, FGF2 and FGFR1c [44] (link). The assay was performed as described previously [45] (link) in the presence of 0.03 nM FGF2 and either unfractionated heparin (0–0.5 μg/mL; Sigma H3393) or MPS IIIA GAG (0–2 μg/mL). The relative number of cells present was determined using the MTS reagent (Promega, Madison, Wisconsin, USA) by addition to the cell cultures for 6 h prior to measurement of absorbance at 490 nm.
Lehmann R.J., Jolly L.A., Johnson B.V., Lord M.S., Kim H.N., Saville J.T., Fuller M., Byers S, & Derrick-Roberts A.L. (2021). Impaired neural differentiation of MPS IIIA patient induced pluripotent stem cell-derived neural progenitor cells. Molecular Genetics and Metabolism Reports, 29, 100811.
+ Open protocol
+ Expand
3

Isolating Mouse Cortical Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mice were deeply anaesthetized using intra-peritoneal injection of combinatorial ketamine (90 mg/kg) and xylazine (4.5 mg/kg, K113, Sigma). Mice were cardiac perfused with ice-cold heparinized PBS (1U/ml, H3393, Sigma). Brains were then excised and separated for use in immunohistochemistry or for RNA/protein biochemical analysis. Isolation of the cortex for RNA/protein biochemistry was performed using a modified dissection technique [24 (link)]. Hemispheres were placed on an ice cold glass dissection plate and orientated in a sagittal plane. The cerebellum was removed, and the striatum, thalamus, midbrain and brain stem remnants were identified. These structures were then removed using sterilized blunt spatulas, exposing the hippocampal complex and interior wall of the cortex. The hippocampus was then peeled away from the cortex, and cortical tissue was snap frozen in liquid nitrogen and stored at −80 °C until required.
Minter M.R., Moore Z., Zhang M., Brody K.M., Jones N.C., Shultz S.R., Taylor J.M, & Crack P.J. (2016). Deletion of the type-1 interferon receptor in APPSWE/PS1ΔE9 mice preserves cognitive function and alters glial phenotype. Acta Neuropathologica Communications, 4, 72.
+ Open protocol
+ Expand
4

Isolation of Mouse Red Blood Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To isolate red blood cells, mice were euthanized by cervical dislocation followed by collection of ~200 µL whole blood via cardiac puncture into tubes containing 7.5 µL heparin (1000USP/mL, H3393, Sigma Aldrich). The cells were incubated on ice for ~5 min, then centrifuged (5 min, 500 rpm, 4 °C) followed by aspiration of the serum and buffy coat layer. Cells were gently resuspended in PBS and then pelleted (5 min, 500 rpm, 4 °C) three times. Cells were then resuspended in RPMI media and used immediately for experiments.
Ghergurovich J.M., García-Cañaveras J.C., Wang J., Schmidt E., Zhang Z., TeSlaa T., Patel H., Chen L., Britt E.C., Piqueras-Nebot M., Gomez-Cabrera M.C., Lahoz A., Fan J., Beier U.H., Kim H, & Rabinowitz J.D. (2020). A small molecule G6PD inhibitor reveals immune dependence on pentose phosphate pathway. Nature chemical biology, 16(7), 731-739.
+ Open protocol
+ Expand
5

PCV2 Capsid Antibody Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Epigallocatechin gallate (EGCG, 99.91% purity, HY-13653, Medchemexpress, Monmouth, NJ, USA), epicatechin (EC, 99.00% purity, HY-N0001, Medchemexpress) and heparin (99.00% purity, H3393, Sigma-Aldrich, St. Louis, MO, USA) were dissolved into ddH2O at a concentration of 50 mM for storage. The monoclonal antibody (mAb) 5E11 against PCV2 capsid was generated in our laboratory [34 (link)]. The fluorescein isothiocyanate (FITC) conjugated goat anti-mouse IgG (ab6785, Abcam, Cambridge, MA, USA), horse radish peroxidase (HRP) conjugated goat anti-mouse IgG (074-1802, KPL, Milford, MA, USA) and Mouse IgG1 Isotype Control (564416, BD Horizon™, San Jose, CA, USA) were purchased from Abcam, Kirkegaard & Perry Laboratories and BD Biosciences, respectively.
Li J., Song D., Wang S., Dai Y., Zhou J, & Gu J. (2020). Antiviral Effect of Epigallocatechin Gallate via Impairing Porcine Circovirus Type 2 Attachment to Host Cell Receptor. Viruses, 12(2), 176.
+ Open protocol
+ Expand
6

Matrigel Plug Neovascularization Assay

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The Matrigel plug neovascularization assay has been used in our previous publication [22 (link)]. In detail, mice were anesthetized by inhalation of 3% isoflurane and exposed for 10 min in this assay. Mice were injected subcutaneously with growth factor reduced (GFR) basement membrane matrix (Corning® Matrigel, 356231, Glendale, AZ, USA) containing 30 ng/mL VEGF (Peprotech, 100-20, Rocky Hill, CT, USA) and 50 U/mL heparin (Sigma-Aldrich, H3393, Darmstadt, Germany). The gel formed a solid plug as it reached the body temperature. After 14 days, plugs were collected and homogenized with 500 μL cell lysis buffer and centrifuged at 6000×g at 4 °C for 60 min. A colorimetric assay (Sigma-Aldrich, MAK115, Darmstadt, Germany) was used to detect hemoglobin with a microplate reader at 400 nm wavelength. The plug was harvested for histological and immunohistochemistry analysis.
Chen C., Lin L.Y., Chen J.W, & Chang T.T. (2023). CXCL5 suppression recovers neovascularization and accelerates wound healing in diabetes mellitus. Cardiovascular Diabetology, 22, 172.
+ Open protocol
+ Expand
7

HUVEC Culture and Treatment Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
HUVECs (ATCC#CRL-1730, ATCC, Manassas, VA, USA) were grown in Kaighn’s modification of Ham’s F-12 medium (F-12K) (ATCC#30-2004, ATCC, Manassas, VA, USA) containing 10% fetal bovine serum (FBS) (v/v), heparin solution (final concentration, 0.1 mg/mL; H3393, Sigma-Aldrich, St. Louis, MO, USA), endothelial cell growth supplement (ECGS, #354006, BD Biosciences, San Jose, CA, USA), and antibiotics (penicillin–streptomycin 100 U/mL; Sigma-Aldrich, St. Louis, MO, USA). Cells were maintained in a humidified atmosphere of 5% CO2/95% at 37 °C. These cells were plated in 6-well plates at a density of 0.5 × 106 cells per well and harvested at 4 days after treatment with PFF (final concentration, 1 µg/mL) or phosphate-buffered saline (PBS). DMSO (#276855, Sigma-Aldrich) or 1,25-(OH)2D3 (Calcitriol, #17936, Sigma-Aldrich) treatment was provided for 24 h prior to harvest.
Kim H., Shin J.Y., Lee Y.S., Yun S.P., Maeng H.J, & Lee Y. (2020). Brain Endothelial P-Glycoprotein Level Is Reduced in Parkinson’s Disease via a Vitamin D Receptor-Dependent Pathway. International Journal of Molecular Sciences, 21(22), 8538.
+ Open protocol
+ Expand
8

HNRNPC PROTEIN INTERACTIONS VIA PAR-CLIP

Check if the same lab product or an alternative is used in the 5 most similar protocols
A-seq2 libraries were generated as previously described (Gruber et al. 2014 (link)) and sequenced on an Illumina HiSeq 2500 sequencer. The HNRNPC PAR-CLIP was performed as previously described (Martin et al. 2012 (link)) with a modification consisting of preblocking of the Dynabeads–Protein A (Life Technologies), resulting in reduced background and higher efficiency of library generation. To this end, Dynabeads were washed three times with PN8 buffer (PBS buffer with 0.01% NP-40), and incubated in 0.5 mL of PN8-preblock (1 mM EDTA, 0.1% BSA from Sigma [A9647], and 0.1 mg/mL heparin from Sigma [H3393], in PN8 buffer) for 1 h on a rotating wheel. The preblock solution was removed and replaced by the antibody in 0.2 mL preblock solution and rotated for 2–4 h. We used the goat polyclonal antibody sc-10037 against HNRNPC (Santa Cruz Biotechnology). The 5′ adapter was GTTCAGAGTTCTACAGTCCGACGATC and the 3′ adapter was TGGAATTCTCGGGTGCCAAGG.
Gruber A.J., Schmidt R., Gruber A.R., Martin G., Ghosh S., Belmadani M., Keller W, & Zavolan M. (2016). A comprehensive analysis of 3′ end sequencing data sets reveals novel polyadenylation signals and the repressive role of heterogeneous ribonucleoprotein C on cleavage and polyadenylation. Genome Research, 26(8), 1145-1159.
+ Open protocol
+ Expand
9

Quantifying Total HS and HS-AT+ Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total HS was isolated from left ventricle tissue and quantified by dye binding, as previously described [33 (link)]. HSAT+ specific activity was assessed as the in vitro activity of HS to enhance AT neutralization of factor Xa with monitoring of S2765 cleavage by factor Xa, as previously described. Activity was calibrated against a standard curve of porcine heparin (179 USP U/mg) (H-3393; Sigma Aldrich).
Smits N.C., Kobayashi T., Srivastava P.K., Skopelja S., Ivy J.A., Elwood D.J., Stan R.V., Tsongalis G.J., Sellke F.W., Gross P.L., Cole M.D., DeVries J.T., Kaplan A.V., Robb J.F., Williams S.M, & Shworak N.W. (2017). HS3ST1 Genotype Regulates Antithrombin’s Inflammomodulatory Tone and Associates with Atherosclerosis. Matrix biology : journal of the International Society for Matrix Biology, 63, 69-90.
+ Open protocol
+ Expand
10

Isolated Brain Microvascular Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The brain microvascular endothelial cell (BMEC) isolation was performed as previously described [14 (link)]. The purified BMECs were plated on collagen type IV and fibronectin (Sigma-Aldrich, # C5533 and # F1141) coated tissue culture plates and cultured in endothelial cell culture medium consisting of DMEM supplemented with 20% platelet-poor bovine plasma derived serum (PDS, from Biomedical Technologies, # BT-214), heparin at 1 μg/mL (Sigma-Aldrich, # H3393), L-glutamine at 2 mM (Sigma-Aldrich, # G8540), 100× Antibiotic-Antimycotic (Life Technologies, # 15240-062), and basic fibroblast growth factor at 1 ng/mL (bFGF, R&D Systems, # 233-FB). For the first two days of culture, the medium also included 4 μg/mL of puromycin (Sigma-Aldrich, # P8833) for BMEC purification purposes. Upon reaching confluence, BBB properties were induced by changing to serum-free medium consisting of 50% DMEM and 50% Ham’s F-12 (Life Technologies, #11765-054) with L-glutamine at 2 mM and Antibiotic-Antimycotic supplemented with 550 nM hydrocortisone for 24 hours before use.
The primary rat heart and lung microvascular endothelial cells (HEC/LEC) were obtained from VEC Technologies (Rensselaer, NY), and cultured per manufacturer’s instructions on fibronectin coated tissue culture plates in MCDB-131 complete media (VEC technologies).
Jones A.R., Stutz C.C., Zhou Y., Marks J.D, & Shusta E.V. (2014). Identifying Blood-Brain Barrier Selective Single-Chain Antibody Fragments. Biotechnology journal, 9(5), 664-674.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!