Total RNA was extracted from snap-frozen tissues using Tripure RNA isolation reagent (Roche). Complementary DNA was generated using M-MLV reverse-transcriptase (Promega). Quantitative reverse transcription–polymerase chain reaction was performed on a CFX96 PCR machine (Bio-Rad), and expression levels were normalized to the housekeeping gene GAPDH. Primer sequences: Gapdh Fwd: GGGGCTGGCATTGCTCTCAA; Rev: TTGCTCAGTGTCCTTGCTGGGG; Gr Fwd: CCCTCCCATCTAACCATCCT; Rev: ACATAAGCGCCACCTTTCTG; Ar Fwd: GCCTCCGAACTGTGGTATCC; Rev: CCTGGTACTGTCCAAACGCA; Ncoa1 Fwd: GCGAGTCAAAGGGTGCAGTT; Rev: CCAGCCCGAAGCACATACA; Ncoa2 Fwd: CGTCACCAACTGAGAAGCCA; Rev: GGACGGGTCAGAGGTGTTGTTTT; Hsd11b1: Fwd: AGTACACCTCGCTTTTGCGT; Rev: CTCTCTGTGTCCTTGGCCTC. Hsd11b2: Fwd: CACTCGAGGGGACGTATTGT; Rev: CGTTTCTCCCAGAGGTTCAC. Baseline expression (CT-values) for each gene is shown in Supplementary Table S1 [39 (link)].
Tripure rna isolation reagent
Manufactured by Roche
Sourced in Germany, Switzerland, United States
TriPure RNA isolation reagent is a single-solution reagent for the isolation of total RNA from a variety of biological samples. It is designed to effectively extract and purify RNA from cells and tissues.
Automatically generated - may contain errors
Lab products found in correlation
M mlv reverse transcriptase, by Promega (3 mentions)
Lightcycler 480 sybr green 1 master reagent, by Roche (3 mentions)
Lightcycler 480 system, by Roche (3 mentions)
Moloney murine leukemia virus reverse transcriptase, by Promega (3 mentions)
Cfx96 pcr machine, by Bio-Rad (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Sybr green realtime pcr master mix, by Toyobo (2 mentions)
M mlv rt, by Promega (2 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (2 mentions)
Gotaq qpcr master mix, by Promega (2 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Proline, by Thermo Fisher Scientific (1 mentions)
Fungizone, by Thermo Fisher Scientific (1 mentions)
Ultrapure escherichia coli lps, by InvivoGen (1 mentions)
Trypsin edta, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Poly l lysine (pll), by Merck Group (1 mentions)
Iq sybr green supermix, by Bio-Rad (1 mentions)
Trypsin, by BD (1 mentions)
33 protocols using tripure rna isolation reagent
1
Quantitative gene expression analysis
2
Tissue Sampling for Multi-Omics Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The thigh muscle tissues were divided into four specimens. One was fixed in 10% formalin for Hematoxylin-Eosin (HE) staining and one was immersed in stationary liquid for electron microscope assays. The third was immersed into TriPure RNA isolation reagent (Roche, Basel, Switzerland) and reserved at 4°C for real time-PCR examination. The fourth was frozen in liquid nitrogen for 1 minute and then stored at −80°C for Western blot analysis.
3
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from snap-frozen mouse liver samples (approx. 30 mg) using a tripure RNA isolation reagent (Roche) according to the manufacturer’s protocol. Total RNA (1 μg) was reverse transcribed using Moloney murine leukemia virus (M-MLV) reverse transcriptase (Promega) for qRT-PCR according to the manufacturer’s instructions to produce cDNA. mRNA expression was normalized to β2-microglobulin mRNA expression and expressed relative to WT mice using the ΔΔCt method. The primer sequences used are listed in Table 1 below.
4
Total RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mouse tissues using TriPure RNA isolation reagent (Roche) according to the product manual. To analyze N2 worms at day 11 of adulthood a total of approximately 3,000 worms per condition, divided into three biological replicates, was recovered in M9 buffer from NGM plates and lysed in the TriPure RNA reagent. Each experiment was repeated twice. Total RNA was transcribed to cDNA using the QuantiTect Reverse Transcription Kit (QIAGEN). Expression of selected genes was analyzed using the LightCycler480 system (Roche) and LightCycler 480 SYBR Green I Master reagent (Roche). For worms two housekeeping genes were used to normalize the expression data, actin (act-1) and peroxisomal membrane protein 3 (pmp-3); for mice, the β2-microglobulin (B2m) gene was used as housekeeping reference.
5
RNA Isolation from S. pombe and Mammalian Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from S. pombe was isolated as described previously (Arimbasseri et al. 2015 (link)) using hot-phenol. Total RNA from mammalian cells was prepared using Tripure RNA isolation reagent (Roche, Basel).
6
Murine Cell Culture Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Culture media, foetal bovine serum (FBS), horse serum (HS), penicillin-streptomycin, fungizone, proline, trypsin-EDTA and PCR primers were purchased from Invitrogen (Merelbeke, Belgium). Poly-L-lysine was obtained from Sigma (Bornem, Belgium) and ultrapure Escherichia coli LPS from InvivoGen (Toulouse, France). Percoll™/RediGrad™ reagent was acquired from GE Healthcare (Uppsala, Sweden). TriPure RNA Isolation Reagent was bought from Roche Diagnostic (Vilvoorde, Belgium) and iScript cDNA Synthesis Kit as well as IQ™ SYBR® Green supermix from BioRad Laboratories (Nazareth, Belgium). Culture plastic ware was purchased from Greiner Bio-one (Wemmel, Belgium).
7
Nicotine Treatment in Cell Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nicotine was purchased from Sigma Chemical Co (Poole, Dorset, UK); DMEM, FCS (fetal calf serum), penicillin, streptomycin were obtained from Gibco-BRL (Paisley, UK). Trypsin was from BDH-England. 5-mC DNA enzyme-linked immunosorbent assay (ELISA) kit was purchased from Zymo Research (Freiburg, Germany). Tripure RNA isolation reagent was from Roche Applied Sciences (Indianapolis, Indiana, USA). cDNA (complementary DNA) synthesis kit was purchased from Fermentas Life Science (Waltham, Massachusetts, USA). A real-time PCR master mix was obtained from amplicon (Odense, Denmark).
8
Quantitative Gene Expression Analysis of Muscle and Fat
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Skeletal muscle and WAT biopsies were homogenized in 1 mL TriPure RNA Isolation reagent (Roche, Mannheim, Germany) and RNA was extracted according to the manufacturer's instructions. One microgram (1 µg) RNA was reverse-transcribed using a Promega solution kit (Promega, Madison, WI, USA) for cDNA synthesis. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed with a CFX96 PCR device (Bio-Rad, Hercules, CA, USA) using SYBR green (Promega). Primer sequences of genes involved in Wnt and insulin signaling as well as housekeeping genes are listed in Supplementary Table 1 . mRNA expression was normalized to ribosomal protein S18 (RPS18) for WAT and LRP10 for skeletal muscle, and expressed as arbitrary units for South Asians compared with White Caucasians using the ΔΔCT method. Due to insufficient RNA yield, data on WAT of one South Asian and one white Caucasian participant were excluded, as well as data on skeletal muscle of one white Caucasian participant.
9
Transcriptomic Analysis of S. aureus in Burn Serum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Staphylococcus aureus Newman and ATCC25923 were challenged with 50% burn or sham serum and grown to late exponential phase. Total RNA was isolated using TriPure RNA isolation reagent (Roche) and reverse transcribed to cDNA using a first-strand cDNA synthesis kit (Thermo Fisher Scientific). qRT-PCR was then performed in a 7500 real-time PCR system (Applied Biosystems) using SYBR green real-time PCR master mix (TOYOBO). 16S rRNA was used as an internal control. Genes and their corresponding qRT-PCR primers are listed in Supplementary Table S1 . Fold changes in gene transcript levels were quantified using the comparative threshold cycle (ΔΔCT) method. Results are expressed as relative fold changes in transcript levels in bacteria cultured in burn serum, compared to the values observed for bacteria cultured in sham serum, with the latter normalized to a value of 1.
10
Meiotic Differentiation of Mouse Embryonic Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from differentiated mESC after 5, 15 and 30 days of RA induction by using TriPure RNA isolation reagent (Roche) according to the manufacturer’s instructions. Then about 1µg of total RNA was subjected for cDNA synthesis using MMLV reverse transcriptase and random hexamers (RevertAid ™ First Strand cDNA Synthesis Kit, Fermentas). RT-PCR was performed using specific primers during different stages of meiotic differentiation. Also, phosphoglucomutase-1 (Pgm1) was used as the housekeeping gene to check the quality and the amplification reaction of cDNAs. The RT-PCR was performed in 95°C for 3 min followed by 30 cycles of 95°C for 30 sec, 60°C for 30 sec, 72°C for 20 sec, and final extension at 72°C for 10 min in a final reaction volume of 25 µl. The sequences of primers used in this study are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!