Viral RNA was extracted using a Miracle-AutoXT Automated Nucleic Acid Extraction System (iNtRON Biotechnology, Seongnam, Korea). To identify subtypes, qRT-PCR was conducted using the TOPreal™ One-step RT qPCR Kit (Enzynomics, Daejeon, Korea) with influenza-specific primers as previously described [35 (link)]. Species identification was performed using mitochondrial cytochrome C oxidase I mitochondrial gene in the DNA of fecal samples, as previously described [36 (link)].
Topreal one step rt qpcr kit
Manufactured by Enzynomics
Sourced in Cameroon
The TOPreal™ One-step RT qPCR Kit is a laboratory equipment product designed for reverse transcription and real-time quantitative PCR analysis. It provides a streamlined, one-step solution for the detection and quantification of RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Cfx96 touch real time pcr detection system, by Bio-Rad (2 mentions)
Miracle autoxt automated nucleic acid extraction system, by iNtRON Biotechnology (1 mentions)
Minibest universal rna extraction kit, by Takara Bio (1 mentions)
Topscript reverse transcriptase kit, by Enzynomics (1 mentions)
Quantstudio 5 flex real time pcr system, by Thermo Fisher Scientific (1 mentions)
8 protocols using topreal one step rt qpcr kit
1
Molecular Identification of Influenza Subtypes
2
RT-qPCR Analysis of Stemness and Immune Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was purified using MiniBEST Universal RNA Extraction Kit (Takara, Tokyo, Japan). RT-qPCR was performed using a TOPreal™ One-step RT-qPCR Kit (Enzynomics, Daejeon, South Korea). Our studies followed the manufacturer’s protocol. GAPDH primer was synthesized, and other primers (CD44, c-Myc, OCT4, SOX2, PD-L1, RelB, interleukin-6 [IL-6], and IL-8) were purchased in Bioneer. The GAPDH gene has been experimented with for use as an internal control. Primer sequences that were used to perform RT-qPCR are shown in Table 1 .
Primer sequences of target genes for reverse-transcription quantitative polymerase chain reaction
| Gene name (human) | Primer sequences | |
|---|---|---|
| Forward | Reverse | |
| CACATGGCCTCCAAGGAGTAA | TGAGGGTCTCTCTCTTCCTCTTGT | |
| AATGAAAGGCCCCCAAGGTAGTTATCC | AGCAAAACCCGGAGGAGT | |
| AGAAGGTGTGGGCAGAAGAA | AAATGCACCATTTCCTGAGA | |
| AGCAAAACCCGGAGGAGT | CCACATCGGCTGTGTATATC | |
| TTGCTGCCTCTTTAAGACTAGGA | CTGGGGCTCAAACTTCTCTC | |
| AAAGTCAATGCCCCATACGG | TTCTCTTCCCACTCACGGGT | |
| GTCTTTCCCCACGAGGCTAT | CCGTACCTGGTCATCACAGAG | |
| ATGAACTCCTTCCTCCACAAGCGC | GAAGAGCCCTCAGGCTGGACTG | |
| CATACTCCAAACCTTTCCACCCC | TCAGCCCTCTTCAAAAACTTCTCCA | |
3
Comparison of NESBA and RT-qPCR Techniques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 3
To verify the practicability of the NESBA technique of the present invention, an experiment for detecting a target RNA using a commercialized reverse transcription PCR kit was carried out, and the results were compared with the performance of a NESBA technique. In the practicability verification experiment of the present example, a TOPreal™ One-step RT qPCR kit (Enzynomics co Ltd.) was used, and the target RNA detection experiment was performed according to an experimental method provided by the above product. As a result of performing an experiment for detecting a target RNA at various concentrations (0.2 pM, 2 pM, 20 pM, 200 pM, and 2000 pM) by using the reverse transcription PCR kit, it was confirmed that the reverse transcription PCR technique exhibited a limit of detection of the target RNA of 0.52 fM (see
4
Quantifying RPL21 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The real-time PCR primers for the RPL21 gene (primers 15 and 16; Table 1 ) were designed according to the mRNA sequences cloned in this study. The cDNAs were synthesized from total RNA that was extracted from 7 different tissues (kidney, heart, liver, lung, ovary, intestine, and skin) and 3 types of cell lines (wild-type fibroblast, transient RPL21-overexpressed fibroblast, and RPL21-knockdown fibroblast) by using the TOPscript Reverse Transcriptase kit (Enzynomics, Korea). The RPL21 expression levels of the different pig tissues were compared by using a standard curve method as previously described [19 (link)]. Briefly, a standard curve was constructed with serial ten-fold dilutions of the pCX-RPL21 plasmid DNA by performing real-time PCR. Then the cycle threshold (Ct) value that was obtained from each sample was transformed into a copy number according to the standard curve. The PCR was performed with primers 15 and 16 by using the TOPreal One-step RT qPCR Kit (Enzynomics) with the following conditions: 40 cycles of 10 sec denaturation at 95℃, 15 sec annealing at 64℃ with a 0.1℃ decrease in each cycle for 30 cycles, and a 20 sec extension at 72℃. When comparing the RPL21 expression levels in the same tissue or cell line, we normalized the expression level against a housekeeping gene, GAPDH (primers 13 and 14).
5
SEOV Detection by One-Step RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR was performed using the TOPreal™ One-step RT qPCR Kit (Enzynomics, Daejeon, ROK) according to the manufacturer’s instructions. The optimal reaction mixture contained 1 µL of the RNA template, 1 µL of TaqMan probe (10 nM), 1 µL of forward and reverse primers (each 10 nM), 5 µL of TOPreal One-step RT-qPCR kit mix, and 12 µL of nuclease-free water in a final volume of 20 µL. The primer and probe sequences were SEOV-SF-1 (forward primer), 5′-GAC AGG ATT GCA GCA GGG AA-3′, SEOV-SR-1 (reverse primer): 5′-CGG CTC TAC CCC TGT AGG ATC-3′, and SEOV-SP-1 (probe): 5′-FAM-AAC ATC GGG CAA GAC CG-MGB-3′. The PCR was performed in triplicate on a Biomeme Franklin Three Real-Time PCR thermocycler system (Biomeme) and a Quantstudio 5 Flex Real-Time PCR System (Applied Biosystems) using the following cycling conditions: 30 min at 50 °C and 10 min at 95 °C, followed by 45 cycles of 5 s at 95 °C and 30 s at 60 °C. The cutoff value is 40.
6
Quantitative RT-qPCR Analysis of Nematode-Induced Transcripts in Korean Red Pine
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Preparation of total RNA from Korean red pines was performed using RNA isolation kit (TAESIN), and quantitative reverse-transcription PCR (RT-qPCR) was conducted using the TOPreal One-step RT qPCR Kit (Enzynomics, Daejeon, South Korea). 12 DEGs in trees inoculated with B. xylophilus relative to those inoculated with B. thailandae were used for RT-qPCR with a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Expression levels of the genes were calculated by the comparative threshold method, with EIF4A-2 as the internal control. The Pearson correlation coefficient between RT-qPCR and RNA-Seq was analyzed with the R statistical software35 . Primer sequences are listed in Supplementary Table S1 and a related script for correlation analysis in R were presented in Supplementary Data S3 .
7
Isolation and Subtyping of Influenza Viruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each sample was suspended in phosphate-buffered saline (pH 7.2) containing antibiotics (100 U/μL of penicillin and 100 U/μL of streptomycin) and centrifuged at 3000 rpm for 10 min. The 0.45-μm filtered supernatants were inoculated into 9–11-day-old specific pathogen-free (SPF) embryonated chicken eggs (Seng-Min Inc., Hwaseong, Korea) and incubated at 37 °C for 72 h. Allantoic cavity fluids were harvested for hemagglutinin assays. To detect the virus, a quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) kit (iNtRON Biotechnology, Seongnam, Korea) was used to amplify the matrix gene. Viral RNA in positive allantoic fluid was extracted using the Viral DNA/RNA Mini Kit (Wizbiosolutions, Seongnam, Korea). To determine subtypes, qRT-PCR was performed using the TOPreal™ One-step RT qPCR Kit (Enzynomics, Daejeon, Korea) with influenza-specific primers and probes [13 (link)].
8
Real-Time RT-PCR Sensitivity Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the sensitivity of our multiplex RT-LAMP assay for application to real-time RT-PCR approaches, the extracted RNA samples were serially diluted from 3 × 105 to 3 × 101 copies per μL. Real-time RT-PCR was performed using TOPreal™ One-step RTqPCR Kit (Enzynomics, Republic of Korea) with 10 pmol of outer primers (F3 and B3, see Table 1 ) and 1 μL of serially diluted RNA. The following real-time RT-PCR conditions were carried out on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA): reverse transcription at 55 °C for 30 min, initial denaturation at 95 °C for 5 min, 40 cycles of three steps: denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, elongation at 72 °C for 30 s, and final elongation at 72 °C for 5 min. The results were analyzed using CFX manager software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!