Trizol rna isolation reagent

Total RNA content of cells was extracted using TRIzol RNA isolation reagent (Invitrogen) [28 (link)]. Retrotranscription and real-time PCR was performed as we previously described [27 (link)] PCR reaction and real-time detection was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, A25742) and QuantStudio 12K Flex System (Thermo Fisher Scientific). The real-time PCR thermocycles were the followings: 95°C 10 min (1x), 95°C 15 s, 60°C 1 min (40x), 95°C 15 sec, 60°C 1 min, 97°C 15 s (1x). The primers were as follows: for PERK: (forward) 5’-AAAGCAGTGGGATTTGGATG-3’ and (reverse) 5’-TCTTGGTCCCACTGGAAGAG-3’, for NRF2: (forward) 5’-TCCAGTCAGAAACCAGTGGAT-3’ and (reverse) 5’-GAATGTCTGCGCCAAAAGCTG -3’, for GAPDH: (forward) 5’-TGCACCACCAACTGCTTAGC-3’ and 5’-GGCATGGACTGTGGTCATGAG-3’.

Both DNA and RNA extraction used 50 to 100 mg of snap frozen tissue. DNA was extracted from tissue using the DNeasy Blood and Tissue Kit (Qiagen) as per the manufacturer's instructions. RNA was extracted using TRIzol RNA Isolation Reagent (Invitrogen), precipitated with chloroform, and cleaned up using the RNeasy Mini Kit (Qiagen). For sequencing, applications DNA and RNA quality (RIN score) was quantified using the Agilent 2100 Bioanalyzer. A minimum RIN threshold of 8 was used for RNA sequencing (RNA-seq).

Total RNA was extracted from AsPC-1 and AsPC-1/GR cells using TRIzol RNA isolation reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. RNA quality and quantity were assessed using capillary electrophoresis with Fragment Analyzer and Standard/High Sensitivity RNA Analysis kits (Advanced Analytical Technologies, Ames, IA). To identify the lncRNA profiles associated with chemoresistance of pancreatic cancer, an Affymetrix GeneChip Human Transcriptome Array 2.0 (Affymetrix) was used according to the manufacturer’s protocol. Biotinylated complementary DNA (cDNA) was prepared from 500 ng of total RNA. After labelling and hybridization, the GeneChips were washed and stained using an Affymetrix Fluidics Station 450 and then scanned with an Affymetrix GeneChip Scanner 3000 7G. The data were analysed with a Robust Multichip Analysis algorithm using the Affymetrix default analysis settings with global scaling as the normalization method. To determine the significance of the differences and the false discovery rate (FDR), thresholds of P < 0.05 and FDR < 0.05 were used. Gene expression fold changes of either > 2 or < 0.5 were set as the default filter criteria for identifying significant differentially expressed genes.

Anaesthetic ether, xylene, chloroform and formalin were purchased from Beijing Chemical Works (Beijing, China). Ethanol was obtained from Shandong LIRCON Medical Technology Co., Ltd. TRIzol RNA isolation reagent was purchased from Invitrogen (Carlsbad, USA). miScript HiSpec Buffer, miScript Nucleics Acid Mix, miScript Reverse Transcriptase Mix, RNase-free water oligo primer, reaction buffer, dNTPs, revertase, and RNase inhibitor were obtained from Qiagen (Dusseldorf, Germany).

The total RNA was extracted from LX-2 cells using the Trizol RNA isolation reagent (Invitrogen, USA) following the manufacturer's protocol. The RNA was then reverse-transcribed into complementary DNA (cDNA) using the RevertAid First-Strand cDNA Synthesis Kit with Oligo (dT) 18 primers (Thermo Fisher Scientific, USA) as previously described [17] (link). The cDNA products were then used as the templates for qRT-PCR using a SYBR Premix Ex Taq Kit (Takara, Japan) on the Eco Real-Time PCR Sequence Detection System (Illumina, USA). The target gene values were normalized to GAPDH values and expressed as relative fold increases 2^(−ΔΔCt) over the non-treated samples.

Total RNA was isolated using the Trizol®RNA isolation reagent (Invitrogen) and quantitative data was recorded. cDNAs were reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit (Fermentas). The target gene fragments were amplified using real time-PCR (RT-PCR). Maxima SYBR Green (Thermo Scientific, Waltham, MA, USA) was used for staining. The target gene expression was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH): primers: MAP2 (forward 5′- AACATACCACCAGCCCTTTG -3 ′, reverse 5′ -GCCTTTCCTTCGTCTTTCCT-3′); PKA (forward 5′-AGCCAAAGCCAAGGAAGATT-3′, reverse 5′-AGCATCACTCGCCCAAAG-3′); PPAR-γ (forward 5′-CGAGAAGGAGAAGCTGTTGG-3′, reverse 5′- TCAGCGGGAAGGACTTTATG-3′).