Pfu dna polymerase

The TtAG gene (ttag) was amplified from the genomic DNA of Thermus thermophilus TC11 by PCR with a primer pair of the forward (5′-GCTAGCTAGCATGCTTCAAAGAAC-3′, where the underline indicates the NheI site) and the reverse (5′-CCGGAATTCCTATTTCACTACAATC-3′, the underline indicates the EcoRI site) and pfu DNA polymerase (Takara). The PCR product was purified using the Gel Extraction Kit (OMEGA Bio-tek, USA) and then digested with NheI and EcoRI to insert the digested pET28a vector. The resultant recombinant plasmid, pET28a-ttag, was transformed into E. coli BL21 (DE3) for gene expression.

The experiments were carried out according to standard protocols
[41 ]. Polymerase chain reaction (PCR) was performed using Pfu DNA polymerase (TaKaRa, Dalian, China) according to the manufacturer’s instructions.

Bisulfite sequencing was performed as described previously (12 (link)). Briefly, genomic DNA (about 3 μg) from five replicates of 35-DAF endosperm and embryo from the cross ZB107×ZB306 was isolated using the Plant DNeasy Minikit (Qiagen, Valencia, CA, USA), and then was shared by sonication to fragments of 300–500 bp. Custom Illumina adapters were ligated following the manufacturer's protocols. Fragments with adapters were bisulfite converted twice by sodium bisulfite using EpiTech Bisulfite Kits (Qiagen, Valencia, CA, USA) and then amplified by 18 cycles of polymerase chain reaction (PCR) using Pfu DNA polymerase (TaKaRa, Dalian, China). Following this process, the libraries were sequenced at BGI (Shenzhen), generating paired-end 90 bp reads from each library.

The full open-reading frame of PtrWRKY89 was amplified with gene-specific primers (forward, 5′-AGTTCTTGACACCCACCACTC-3′; reverse, 5′- GGAAAATACAAAGAGGCTGC-3′; Joint Genome Institute, http://genome.jgi-psf.org/poplar/poplar.info.html) by RT-PCR with 2 μl cDNA from leaves. The PCR reaction was carried out with Pfu DNA polymerase (TaKaRa) in a total volume of 50 μl with an initial denaturing step at 94°C for 3min, 34 cycles of 94°C for 45 s, 54°C for 30 s, and 72°C for 90 s, and a final extension step at 72°C for 10min. The amplification products were cloned into the plant binary vector pCXSN, which is a zero-background TA cloning system that provides simple and high-efficiency direct cloning of PCR-amplified DNA fragments (Chen et al., 2009a). The resulting vector p35S:PtrWRKY89, containing the PtrWRKY89 open-reading frame under the control of the cauliflower mosaic virus (CaMV) 35S promoter and the hygromycin phosphortransferase gene (Hpt) as a plant-selectable marker conferring hygromycin resistance was transferred into Agrobacterium tumefaciens EHA105 by the freeze-thaw method.

To isolate the full-length cDNA sequence of CtCYP82G24, the flower petals of the JH1 cultivar was used as a source of mRNA which was sampled and placed into liquid nitrogen before RNA extraction. The total RNA content was extracted using RNA Isoplus (Takara Bio Co., Beijing, China), and cDNA templates were synthesized using reverse transcriptase superscript IV (Thermo Fisher Scientific) in a reverse transcription PCR system. The amplification protocol includes the following set of gene primers. The forward primer contained the EcoRI recognition site along with a start codon for translation initiation. On the other hand, the reverse primer consists of a BamHI restriction site just after the stop codon.
CYP-24F:5′ATA $\boxed{\mathrm{G}\mathrm{A}\mathrm{A}\mathrm{T}\mathrm{T}\mathrm{C}}$ TTAATCATAGAGCTCCGAAGA3′ (62 °C)
CYP-24R:5′AATA $\boxed{\mathrm{G}\mathrm{G}\mathrm{A}\mathrm{T}\mathrm{C}\mathrm{C}}$ ATGGCCGACGACTATGGC3′ (58 °C)
The primers were designed according to the Kyoto Encyclopedia of Genes and Genomes Pathway information. The exact PCR product of CtCYP82G24 was amplified with Pfu DNA polymerase (Takara, Beijing, China) and then successfully cloned into the pEASY-T1 vector (Takara, Dalian, China), and the recombinant construct was further transformed into E. coli (TransT1) competent cells through the heat and shock method. Then, the gene of interest in the pEASY-T1 vector was sent for sequencing to observe any base mutation.

Total RNA was isolated from 10⁷ hybridoma cells using RNAiso Plus and cDNA was synthesized with the oligo(dT) priming method (Takara). Primers used were as follows: VH, 5′-GGTBAARCTGVWGSAGTCTGG-3′ and 5′-TGGAGTTAGTTTGGGCAGCAG-3′; VL, 5′- ATGAGGTKCYYTGYTSAGYTYCTGRGG-3′ and 5′- TAACTGCTCACTGGATGGTGG-3′. PCR reactions were performed using pfu DNA polymerase (Takara). The amplification condition was 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 56°C for 1 min, and 72°C for 1 min, with a final extension of 10 min at 72°C. PCR products were electrophoresed through 1.5% agarose gels, and bands of interest were sliced out for DNA extraction followed by sequencing analysis.