ChIP assay was performed using Imprint Chromatin-Immunoprecipitation kit (Sigma) following manufacturer’s instructions. Chromatin was prepared from 3×106 BBM2 tumorspheres and immunoprecipitated using 4 µg of anti-STAT3 rabbit polyclonal antibody (Santa Cruz) or rabbit IgG. The primers listed above were used to amplify the human CPT1B promoter region that contained the putative STAT3-binding sites as suggested by TRANSFAC software and SA Biosciences. STAT3 binding site sequence for CPT1B is 5’-GGGCTCCTACCCGGAAGTGAGC-3’. The relative amount of precipitated DNA were quantified by real time PCR and normalized to input DNA.
Imprint chromatin immunoprecipitation kit
Manufactured by Merck Group
Sourced in United States
The Imprint Chromatin Immunoprecipitation Kit is a laboratory tool designed for chromatin immunoprecipitation (ChIP) experiments. It provides the essential components and protocols for isolating and analyzing specific DNA-protein interactions within a cellular environment.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green pcr master mix, by Thermo Fisher Scientific (6 mentions)
Reversing solution, by Merck Group (3 mentions)
Re chip it magnetic chromatin reimmunoprecipitation kit, by Active Motif (2 mentions)
H3k9ac, by Merck Group (2 mentions)
Antibody against goat igg, by Abcam (2 mentions)
Bioruptor sonication system, by Diagenode (2 mentions)
Ip wash buffer, by Merck Group (2 mentions)
Applied biosystems prism 7500 fast sequence detection system, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
H3k4me3, by Merck Group (2 mentions)
Anti hif 1α antibody, by Novus Biologicals (2 mentions)
H3k4me3, by Cell Signaling Technology (1 mentions)
Maxima sybr green rox qpcr master mix, by Thermo Fisher Scientific (1 mentions)
H3k4me2, by Abcam (1 mentions)
Mycycler thermocycler, by Bio-Rad (1 mentions)
Rabbit anti mecp2 antibody, by Abcam (1 mentions)
Protein a agarose, by Merck Group (1 mentions)
Zymotaq premix, by Zymo Research (1 mentions)
Gapdh, by Merck Group (1 mentions)
Anti gfp, by Abcam (1 mentions)
45 protocols using imprint chromatin immunoprecipitation kit
1
STAT3 Binding to CPT1B Promoter
2
ChIP-seq Analysis of Histone Marks
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The chromatin immunoprecipitation (ChIP) assays were performed using the Imprint® Chromatin Immunoprecipitation Kit (Sigma) following the manufacturer’s protocol and earlier established protocol [54 (link)]. Chromatin was immunoprecipitated against several histone marks, such as H3K36me3, H3K27me1, H3K27me3, H3K4me3, and H3K27Ac. Briefly, isolated RAW 264.7 cells were fixed in 1% formaldehyde, fragmented by sonication. H3K36me3 (Active Motif, 61101), H3K27me3 (Abcam, ab6002), H3K27Ac (Diagenode, C15410174), H3K27me1 (Active Motif, 61015), and negative control IgG (Abcam, ab37373) antibodies were used for immunoprecipitation. After washing and reverse-crosslinking, the precipitated DNA was amplified by primers and quantified by the StepOnePlus real-time-PCR machine (ABI). Primer sequences are provided in the Additional file 4 : Table S2. After RT-qPCR, % of input was calculated by using the following formula: ΔCt (normalized ChIP) = [Ct (ChIP)—{Ct (Input)—Log2 (Input Dilution Factor)}]. Where Input Dilution Factor = (Fraction of the input chromatin saved)−1. Percent (%) Input = 2 (−ΔCt [normalized ChIP]).
3
ChIP-qPCR Analysis of Jagged Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A ChIP assay was performed using an Imprint® Chromatin Immunoprecipitation Kit (#CHP1; Sigma-Aldrich). Cultured HUVEC (80% cell density) were subject to intermittent high-glucose treatment. Treated HUVEC were harvested (1 × 106 cells), washed, and cross-linked with 1% formaldehyde in HiEndoXLTM endothelial cell expansion medium (10 min at room temperature). After washing in PBS, the cell pellet was resuspended in nuclei preparation buffer (200 µl per 106 cells) and kept on ice for 10 min. The nuclear pellet thus obtained was resuspended in shearing buffer (100 µl per 106 cells) supplemented with protease inhibitor cocktail (1 µl per ml of shearing buffer) and further sheared by sonication for 30 s (×40). The sheared chromatin (containing 100–500 bp long sheared genomic DNA) was immunoprecipitated with antibodies directed against H3K4me3 at a concentration of 1:50 (#9751; Cell Signaling Technology). The samples were then washed, reverse cross-linked, and treated with proteinase K to obtain purified DNA fragments. qPCR was performed using primers targeted to amplify regions of human Jagged1 and Jagged2 gene promoters.
4
PTEN-/- Cells Treated with Anacardic Acid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PTEN-/- HCT116 cells were treated with 100μM Anacardic acid for 9hrs after being seeded. 2.0 × 105 cells were used for each single strip well following the protocol with Imprint Chromatin Immunoprecipitation kit from Sigma-Aldrich (Sigma #CHP1-96RXN). The Ac-H4 antibody (sc-8662-R) was used to immunoprecipitate DNA-protein cross-linked complex while the mouse IgG was used as the negative control. The immunoprecipitated promoter sequences of Hsp70s and Hsp90 were detected with real-time PCR.
5
ChIP Assay for Ezrin Promoter Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ChIP assay was conducted using the Imprint Chromatin Immunoprecipitation Kit (Sigma, USA). Briefly, shRGS12 cells or controls were fixed with 1% formaldehyde and nuclear extracts were isolated [57 , 58 (link)]. The sonicated nuclear lysates were immunoprecipitated with anti-YAP antibody or rabbit IgG. Precipitated DNA fragments were amplified by qPCR using primers specific for the Ezrin promoter region. The primers’ sequences used for the quantification are listed in Supplementary Table 1 .
6
ChIP-seq and sequential ChIP analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 1 × 106 control MDA-MB-231 and BT549 cells as well as treated cells or stable clones were fixed with cross-link solution and collected, ChIP assays were performed using Imprint Chromatin Immunoprecipitation Kit (Sigma, #CHP1) according to the manufacturer’s instructions. Antibody-immunoprecipitated DNA was analysed by real-time PCR. Sequential ChIP assay was performed using the Re-ChIP-IT magnetic chromatin reimmunoprecipitation kit (Active Motif, Carlsbad, CA) according to the manufacturer’s protocol. Briefly, the chromatin–IgG, chromatin–FOXD3 or chromatin–BRD4 complex was re-immunoprecipitated using anti-BRD4, anti- FOXD3 or anti-IgG antibodies. After the Re-ChIP assay, the isolated DNA was analysed by quantitative RT-PCR.
7
Chromatin Immunoprecipitation Protocol for Transcriptional Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In all, 0.5 × 106 cells were crosslinked in 1% formaldehyde. Chromatin immunoprecipitation was performed using Imprint Chromatin Immunoprecipitation Kit (Sigma-Aldrich, #CHP1) per manufacturer’s instructions. Sonication was performed using Diagenode bioruptor with the following setup: 30 s on 50% power, 30 s off, 10 cycles. For quantitative ChIP, DNA amplification was performed with Maxima SYBR Green/ROX qPCR Master mix (ThermoFisher Scientific). Percent input was calculated with the formula 100 × 2(Ctadjusted input − CtIP). Input DNA Ct was adjusted from 1% to 100% equivalent by subtracting 6.644 Cts (Log2100) from original Ctinput. Two micrograms of MLL1 (Bethyl, A700-010) or H3K4me2 (Abcam, ab32356) antibodies were used. Primers sequence are MYC promoter: actcacaggacaaggatgcg, gcgcgcctaccattttcttt. PAX2 promoter: caagtcatccatctcccggc, tcccggtgtgtgtctctcta. GAPDH promoter: caattccccatctcagtcgt, tagtagccgggccctacttt.
8
Chromatin Immunoprecipitation Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP analysis was performed using Imprint® Chromatin Immunoprecipitation Kit (Sigma). Briefly, after chromatin cross-linking with 1% formaldehyde and DNA shearing, chromatin-protein complexes were immunoprecipitated from siRNA nonspecific (siNS), siKLF2 and untreated RAW264.7 cells with antibodies against H3K9Ac (Millipore Sigma, 07-352), H4K8Ac (Millipore Sigma, 07-328), P300 (Millipore Sigma, 05-257) and PCAF (Cell Signaling, 3378S). Antibody against goat IgG (Abcam, ab1791) was used as a negative control. Quantitative RT-PCR analysis was performed with the primers described (in Supplementary Table S1 and Figure S1 ). Values obtained from the ChIP assay were normalized to the background obtained from the precipitation with a non-specific antibody. Percentage (%) of input was analyzed by following standard formula. Each experiment was performed in triplicate at least three times.
9
Reg2 Promoter Transcriptional Regulation
10
ChIP-qPCR Analysis of E2F Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) was performed using an Imprint Chromatin Immunoprecipitation Kit (CHP1, Sigma-Aldrich) following the manufacturer’s instructions. Cells were cross-linked in 1% formaldehyde and neutralized using 0.125 M glycine. The chromatin complex was sonicated using Bioruptor Sonication System (Diagenode, Denville, NJ). The sheared chromatin was immunoprecipitated with anti-E2F1 (10 µL per sample for ChIP), anti-E2F2 (4 µg per sample for ChIP), and anti-E2F3 (4 µg per sample for ChIP) ChIP-grade antibodies using the assay wells pre-coated with protein A. The normal mouse or rabbit IgG was used as a non-specific antibody control for immunoprecipitation. Protein–DNA cross-linking was reversed at 65 °C. DNA was purified and analyzed by real-time qPCR. Enrichment of DNA was shown as the percentage (%) input according to the manufacturer’s instruction. The calculation of the % Input for each ChIP fraction is 2(−ΔCt [normalized ChIP]), where ΔCt [normalized ChIP] = (Ct [ChIP] - (Ct [Input] - Log2(Input Dilution Factor))). Primers used in ChIP-qPCR analysis are listed in Supplementary Table 2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!