Gotaq g2 hot start polymerase

General HPV DNA was detected using the GP couple of primers: GP5+ (5′-TTTGTTACTGTGGTAGATACTAC-3′) and GP6+ (5′-GAAAAATAAACTGTAAATCATATTC-3′). The GP6+ primer was biotynilated in order to perform an enzyme-linked assay afterwards. These primers amplify a 150 bp fragment from the L1 region of the HPV genome [32 (link)]. The PCR reaction mix contained 3.5 mM MgCl₂, 0.2 mM dNTP mix, 1 μM of each primer, 0.625 U of GoTaq® G2 Hot Start Polymerase (Promega, USA). The total reaction volume was 25 μl with 5 μl of crude DNA extract. PCR was performed in a T100™ Thermal Cycler (Bio-Rad, USA). The amplification protocol used for this PCR was described by Fontaine et al. [33 (link)]. Amplified fragments were visualized under UV light in a 2% agarose gel (Sigma-Aldrich, USA) incubated in 0.5 μg/ml ethidium bromide solution (Sigma-Aldrich).

HPV DNA was detected with a consensus PCR using the primers GP5+ (5’-TTTGTTACTGTGGTAGATACTAC-3’) and GP6+ (5’-GAAAAATAAACTGTAAATCATATTC-3’), amplifying a 150 bp fragment from the L1 region of the HPV genome [29 (link)]. PCR reactions were carried out in 25 μl of a PCR mixture containing 3.5 mM MgCl₂, 0.2 mM dNTP mix, 1 μM of each primer, 1 U of GoTaq® G2 Hot Start Polymerase (Promega, USA) and 5 μl of crude DNA extract. PCR was performed in a T100™ Thermal Cycler (Bio-Rad, USA). Amplified fragments were visualized in a 2% agarose gel (Sigma-Aldrich, USA) incubated with 0.5 μg/ml ethidium bromide solution (Sigma-Aldrich). Detection of hr-HPV DNA was performed using an enzyme-linked immunoassay as described by Jacobs et al. [30 (link)] . Oligo-probes for detection of 12 h-HPV genotypes were used (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59).

ITS sequences were amplified from extracted DNA using the primer pair UNI_ITS_fw (5′-KRGGRYKAAGTCGTAACAAG-3′) and UNI_ITS_rv (5′-TTTTCRYCTTTCCCTCACGG-3′), targeting the entire spacer region between the 16S rRNA and 23 rRNA genes within the rRNA locus. The amplification was carried out using GoTaq G2 Hot Start polymerase (Promega, USA) on a Verity thermocycler (Applied Biosystems, USA) according to the following protocol: 95°C for 10 min, followed by 32 cycles of 95°C for 1 min, 52°C for 1 min, and 72°C for 1 min and a final step of 72°C for 5 min. The integrity of PCR amplicons was analyzed by gel electrophoresis. The library of ITS amplicons was prepared according to the 16S metagenomic sequencing library preparation protocol (part 15044223, rev. B; Illumina) with modifications in the purification steps. Specifically, the first purification involved 15 μl of Agencourt AMPure XP DNA purification beads (Beckman Coulter Genomics GmbH, Bernried, Germany) in order to remove primer dimers. Then, the second purification step was performed using 30 μl of the above-mentioned purification beads. Sequencing was performed using an Illumina MiSeq sequencer with MiSeq reagent kit v3 chemicals, using 300 cycles.

Genomic DNA was extracted from total BM or flow sorting enriched myeloid, erythroid, T and B cells using the Gentra Puregene Cell kit (Qiagen/158767) according to the manufacturer’s protocol. Fifty nanograms of gDNA were amplified using the GoTaq G2 Hot Start Polymerase (Promega/M7405) under the following conditions: 94 °C 1 min, 60 °C 1 min, 72 °C 1 min for 25 cycles. PCR products were separated on a 1.5% agarose gel containing ethidium bromide. PCR primers are given in Supplementary Table 4.

Two primer pairs were used to amplify the ACCase gene sequence in D. insularis: FE35332 Forward (5′-ATG​TCC​ACT​CCT​GAA​TTC​CCA-3′), FE35333 Reverse (5′-CAT​TCT​GAG​GGA​AGT​ATC​AT-3′). PCR was performed in 25 μL reaction volume containing 5.0 µL of GoTaq Buffer, 0.5 µL of 10 mM dNTPs, 1.5 µL of 25 mM MgCl₂, 0.5 µL of 10 µM of each forward and reverse primers, 0.2 µL of GoTaq G2 Hot Start Polymerase (Promega), and 14.8 µL of ultrapure nuclease-free water (Sigma). PCR cycling conditions were: one cycle at 95°C for 2 min, 35 cycles at 94°C for 30 s, 58°C for 30 s, 72°C for 90 s, and final extension at 72°C for 10 min. PCR product was run on 1.0% agarose gel to verify the amplicon size of 1.5 kb. The amplified samples were purified and sequenced in a Genetic Analyzer 3,500 instrument (Applied Biosystems, Thermo Fisher) following manufacturer’s instructions. Four individuals per population were sequenced using the original amplification primers and the following three internal sequencing forward primers: FE35334 Sequencing Forward 1 (5′- TGG​GAG​AGC​AAA​GCT​TGG​GGT-3′), FE35407 Sequencing Forward 2 (5′- GAA​GTG​CTG​CTA​TTG​CCA​GTG​C -3′) and FE35408 Sequencing Forward 3 (5′- GAC​CCA​CCA​GAC​AGA​CCT​GTT​A -3′). The chromatograms were manually read using Bioedit version 7.2.5 software (Hall, 1999 ) to screen the seven known target-site mutations.

Three primers were designed for the amplification of the empty site and the 3′ junction of the insertion in separate reactions using GoTaq G2 Hot Start polymerase (Promega, Madison, WI, USA) under standard conditions (For 5′ AAGCCTGCAGAATCCAGCTA 3′, Rev 5′ ATCGTGGGGCTTGATCTCAA 3′, internal SVA primer 5′ TGTTTATCTGCTGACCTTCCC 3′). The resulting PCR products were analysed via agarose gel electrophoresis to genotype each sample for the presence or absence of insertion based on product size.

After perfusion with PBS, choroid plexus and kidney tissues were isolated from mice (n = 3), and total RNA was extracted using a ReliaPrep RNA Tissue Miniprep System (Promega, Fitchburg, WI, USA). The cDNA was synthesized with reverse transcriptase using a ReverTra Ace qPCR RT Master Mix (Toyobo). Ten nanograms of cDNA were used as a template, and the specific portions of the two transcripts were amplified with GoTaq G2 Hot Start Polymerase (Promega) and primer sets specific for the SGLT2/SLC5A2 gene (Slc5a2) and the glyceroaldehyde‐3‐phosphate dehydrogenase (GAPDH) gene (Gapdh) (Table 2). PCR amplification cycle conditions were as follows: (i) 2 min at 95C; (ii) 25, 30, or 35 cycles of 30 s at 95C, 15 s at 55C, and 30 s at 72C; and (iii) 5 min at 72°C. The amplicons were electrophoresed on a 2% agarose gel, stained with Midori Green Advance (Nippon Genetics, Tokyo, Japan), and visualized with a blue LED (470 nm) transilluminator (AMZ System Science, Osaka, Japan). Amplified fragments were subjected to direct sequencing (Eurofins Genomics, Tokyo, Japan).