HeLa cells and mouse embryonic fibroblasts (MEFs) were maintained in DMEM supplemented with 10% FBS (Gibco) and 1% penicillin-streptomycin mix in a humidified 37°C incubator with 5% CO2. HeLa cells were seeded at 100,000 cells in 2 ml medium per well in a six-well dish; transfected with 333 ng each of hCas9 (plasmid 41815; Addgene; Mali et al., 2013 (link)), gRNA_AAVS1-T2 (plasmid 41818; Addgene; Mali et al., 2013 (link)), and AAVS1_Puro_PGK_mCherry-progranulin (Nguyen et al., 2018 (link)) plasmids added to the 100 µl of Opti-MEM and 3 µl Fugene 6 transfection mix; and preincubated for 20 min. 48 h after transfection, the transfected cells were selected with puromycin (2 µg/ml) for 2 wk to isolate the surviving cells that stably expressed mCherry-progranulin. An immortalized line of CLN6 mutant MEFs (as well as a WT littermate controls) was generated by serial passaging of primary MEFs from the nclf line of spontaneous mutant mice obtained from The Jackson Laboratory (Todaro and Green, 1963 (link); Gao et al., 2002 (link)).
Grna aavs1 t2
Manufactured by Addgene
GRNA_AAVS1-T2 is a plasmid that can be used to express a guide RNA (gRNA) targeting the AAVS1 locus in human cells. The plasmid contains the necessary components for gRNA expression and can be used in various cell line and model organism applications.
Automatically generated - may contain errors
Lab products found in correlation
Hcas9, by Addgene (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
In fusion cloning, by Takara Bio (1 mentions)
Plvx tetone vector, by Takara Bio (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Geneart gene synthesis, by Thermo Fisher Scientific (1 mentions)
In fusion hd cloning system, by Takara Bio (1 mentions)
Pcas9 gfp, by Addgene (1 mentions)
Q5 high fidelity polymerase, by New England Biolabs (1 mentions)
6 well plate, by Greiner (1 mentions)
Hcas9 d10a, by Addgene (1 mentions)
Plus reagent, by Thermo Fisher Scientific (1 mentions)
Prl tk, by Promega (1 mentions)
Pgl3 basic plasmid, by Promega (1 mentions)
Lipofectamine, by Thermo Fisher Scientific (1 mentions)
4 protocols using grna aavs1 t2
1
Establishing Cell Lines for CRISPR and Progranulin Studies
2
Conditional Expression of AML1/ETO and BIRC5 in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AML1/ETO was PCR amplified using Q5 High-Fidelity Polymerase (New England Biolabs) from a pMSCV-AML1/ETO plasmid (gift from Dr. J. Mulloy). The PCR product was transferred into the EcoRI and AgeI sites of the tetracycline-inducible pLVX-Tet-One vector (Clontech) using In-Fusion cloning (Clontech). A portion of the resulting pLVX-Tet-One vector was then PCR amplified (Forward Primer: 5′- CAGCAGAGATCCAGTTTATCGACTT-3′; Reverse Primer: 5′- TGCAGAATTAATTCCAGGCGGG -3′) and transferred into a plasmid with AAVS1 homology arms (derived from AAVS1-SA-2A-puro-pA donor, Addgene plasmid #22075) using In-Fusion cloning. The inducible, transgene plasmids were then co-transfected into HEK293T cells using Lipofectamine 3000 (Thermo Fisher) along with the gRNA_AAVS1-T2 (Addgene plasmid #41818) and pCas9_GFP (Addgene Plasmid #44719) plasmids. Three days after transfection the resistant cells were selected with puromycin (2 μg/mL). For the BIRC5 gene, the human coding sequence was obtained as GeneArt Gene Synthesis (Invitrogen) and cloned into the EcoRI and BamHI site of the pLVX-Tet-One vector (Clontech) using the In-Fusion HD cloning system (Clontech). This vector was then used to generate lentiviral particles that were used to transduce NIH3T3 cells. After cells were selected with puromycin, doxycycline (1 μg/mL)-inducible BIRC5 mRNA expression was confirmed by quantitative RT-PCR.
3
CRISPR/Cas9 Genome Editing in PER.C6 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PER.C6 cells were plated at a density of 1.5 × 106 cells per well of 6-well plates (Greiner Bio-One). The next day, a total amount of 6 μg of DNA corresponding to 1:1 mixtures of hCas9 (Addgene plasmid 41815) and gRNA_AAVS1-T2 (Addgene plasmid 41818), pAdSh.PGK.Cas9 and pAdSh.U6.gRNAS1, hCas9 and gRNA_Cloning Vector (Addgene plasmid 41824) or hCas9_D10A (Addgene plasmid 41816) and gRNA_AAVS1-T2, were transfected by deploying a 1 mg/ml polyethyleneimine (PEI) solution (Polysciences) essentially as described elsewhere41 (link) except for the use of 6 μg of DNA and 19.7 μl of PEI instead of 6.25 μg of DNA and 18.8 μl of PEI. At 3 days post-transfection genomic DNA from mock-transfected cells and from co-transfected cells, was isolated according to a previously described method42 (link). Targeted gene disruption was assessed by using the T7EI-based assay as described below.
4
CRISPR-Cas9 Activation/Repression in HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa cells were cultured in MEM (HyClone) supplemented with 1% sodium pyruvate, l -glutamate, NEAA and 10% FBS as previously described (94 (link)). 1.5 × 105 HeLa cells were seeded in each T75 flask 16–18 h prior to transfection. Cells were transfected with 100 ng Cas9m4-VP64 (or Cas9m4-KRAB) (95 (link),96 (link)), 100 ng gRNA (either singly or total of a mix), 100 ng of Renilla luciferase- containing plasmid, and 100 ng of plasmid containing the L1 5′ UTR driving Firefly luciferase in the pGL3-basic plasmid (Promega) (83 (link),97 (link)). The Renilla luciferase plasmid contains an HSV-tk promoter, a Renilla luciferase reporter, and a polyA signal (pRL-TK, Promega) as a transfection control. Both plasmids and the gRNAs used are illustrated in Figure 9A . Transfection reaction used 12 uL of plus reagent (Invitrogen) and 5 uL of lipofectamine (Invitrogen). All gRNA pools are designed to transfect the same total amount of gRNA plasmid. The exact gRNA sequences used can be found in Additional File 2. The plasmid containing the gRNA targeting AAV (gRNA_AAVS1-T2) was purchased from Addgene (98 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!