Delta 8

Manufactured by Addgene

Sourced in China

Delta-8.2 is a lab equipment product. It is a device used for scientific and research purposes. The core function of Delta-8.2 is to perform a specific task or measurement related to laboratory work. No further details about its intended use or capabilities are provided.

Automatically generated - may contain errors

Lab products found in correlation

Pcmv vsv g, by Addgene (2 mentions) Vsv g, by Addgene (2 mentions) Penicillin, by Thermo Fisher Scientific (1 mentions) Streptomycin, by Thermo Fisher Scientific (1 mentions) Hek293t, by Addgene (1 mentions) Plko 1 lentiviral vector, by Addgene (1 mentions) Rpmi 1640, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Mda mb 231, by American Type Culture Collection (1 mentions) Accuri c6 flow cytometer, by BD (1 mentions) Hek293t, by American Type Culture Collection (1 mentions) Plenti pgk v5 luc neo, by Addgene (1 mentions) In fusion hd cloning kit, by Takara Bio (1 mentions) Pcdna3, by GenScript (1 mentions) Puromycin, by Merck Group (1 mentions) Pcdna3 deltaova, by Addgene (1 mentions)

5 protocols using delta 8

Lentiviral Transduction of Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cervical carcinoma cell lines Hela, breast carcinoma cell lines MDA-MB-231, and HEK293T were purchased from American Type Culture Collection (ATCC; Manassas, USA). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Carlsbad, USA) or RPMI-1640, supplemented with 10% FBS (Gibco, Carlsbad, USA), 100 units/mL penicillin, and 100 μg/mL streptomycin (Gibco). Lentiviral vector pLKO.1 (Addgene, Watertown, USA) whose backbone with GFP was allowed the ectopic expression of scramble shRNA (5′-TCCTAAGGTTAAGTCGCCCTCG-3′; Sangon Biotech, Shanghai, China) or AHNAK2 shRNA (Sh#1-
h-
AHNAK2-F 5′-CCGGGGTGCGAGTACACGATTTAAACTCGAGTTTAAATCG TGTACTCGCACCTTTTTG-3′, Sh#1-
h-
AHNAK2-R 5′-AATTCAAAAAGGTGCGAGTACACGATTTAAACTCGAGTTTAAATCGTGTACT CGCCC-3′; and Sh#2-
h-
AHNAK2-F 5′-CCGGACGCACAGAGGAAGGATTAAACTCGAGTTTAATCCTTCCTCTGTGCGTTTTTTG-3′, Sh#2-
h-
AHNAK2-R 5′-AATTCAAAAAACGCACAGAGGAAGGATTAAACTCGAGTTTAATCCTTCCTCTGTGCGT-3′; Sangon Biotech), vesicular stomatitis virus G (Addgene), and packaging plasmid Delta 8.9 (Addgene) were co-transfected into HEK293T cells through conventional calcium phosphate method to produce lentivirus. GFP
⁺ cells were selected with BD Accuri C6 Flow cytometer (Franklin Lakes, USA).

Xu M., Cheng A., Yu L., Wei W., Li J, & Cai C. (2022). AHNAK2 is a biomarker and a potential therapeutic target of adenocarcinomas: AHNAK2 is a biomarker for adenocarcinomas. Acta Biochimica et Biophysica Sinica, 54(11), 1708-1719.

+ Open protocol

+ Expand

Lentiviral Production and CRISPR Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols

K562 cells were grown in RPMI-1640 containing 25mM HEPES, 2.0 g/L NaHCO3, 0.3 g/L L-Glutamine supplemented with 10% FBS, 2 mM glutamine, 100 units/mL penicillin and 100 mg/mL streptomycin. Cells were maintained between 0.25 x 10⁶ - 1 x 10⁶/ml. HEK293T cells were grown in Dulbecco’s modified eagle medium (DMEM) containing 10% FBS, 2 mM glutamine, 100 units/mL penicillin and 100 mg/mL streptomycin. hTERT-immortalized RPE1 cells were grown in DMEM:F12 supplemented with 10% FBS, 2 mM glutamine, 100 units/mL penicillin and 100 mg/mL streptomycin. All cell lines were grown at 37°C and 5% CO₂. To produce lentivirus, HEK293T cells were co-transfected with transfer plasmids (pCMV-VSV-G and delta8.9, Addgene #8454) and standard packaging vectors using the TransIT-LT1 Transfection Reagent (Mirus, MIR 2306). Supernatant was collected 48 hours post transfection, centrifuged, aliquoted and flash frozen at −80C until further use. Virus for the genome-wide CRISPRi screens was also generated using this method with one exception – HEK293T cells were seeded in IMDM (Thermo Fisher Scientific #1244053) supplemented with 20% inactivated fetal bovine serum (GeminiBio #100-106). In all instances, virus was rapidly thawed prior to transfection.

Muthukumar G., Stevens T.A., Inglis A.J., Esantsi T.K., Saunders R.A., Schulte F., Voorhees R.M., Guna A, & Weissman J.S. (2023). Triaging of α-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology. bioRxiv.

+ Open protocol

+ Expand

PTPN11 Variant Cloning and Lentiviral Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human embryonic kidney 293 cells were cultured in DMEM 10% fetal bovine serum as per the manufacturer’s instructions. PTPN11 was sequenced in cell lines to verify wild-type sequences. Human PTPN11^WT (NM_002834.5), PTPN11^G1282C, PTPN11^G1381A, and PTPN11^C1403T cDNAs were synthesized and cloned into a pcDNA3.1+ N-HA plasmid, fused in frame at their N-terminus with an HA tag (Genscript Biotech, Piscataway, NJ). Luciferase ORF was excised from pLenti PGK V5-LUC Neo (21471, Addgene, Watertown, MA) by SalI and XbaI combined restriction digestion, and HA-tagged PTPN11 cDNAs were amplified and cloned into the digested pLenti-vector using the In-Fusion HD Cloning kit (638947, Takara Bio, Shiga, Japan), following the on-line primer design tool and the manufacturer's instructions.
Transduction of human embryonic kidney 293T cells with pLenti PGK PTPN11^WT, PTPN11^G1282C, PTPN11^G1381A, or PTPN11^C1403T was done in addition to pCMV-VSVG and delta-8.2 (Addgene) lentiviral plasmids using Lipofectamine 2000‒generated lentiviral particles used to infect human embryonic kidney 293 target cells using 8 μg/ml polybrene to enhance efficiency. Stable cell lines were selected using G418. All variants were verified in cell lines with Sanger Sequencing.

Polubothu S., Bender N., Muthiah S., Zecchin D., Demetriou C., Martin S.B., Malhotra S., Travnickova J., Zeng Z., Böhm M., Barbarot S., Cottrell C., Davies O., Baselga E., Burrows N.P., Carmignac V., Diaz J.S., Fink C., Haenssle H.A., Happle R., Harland M., Majerowski J., Vabres P., Vincent M., Newton-Bishop J.A., Bishop D.T., Siegel D., Patton E.E., Topf M., Rajan N., Drolet B, & Kinsler V.A. (2023). PTPN11 Mosaicism Causes a Spectrum of Pigmentary and Vascular Neurocutaneous Disorders and Predisposes to Melanoma. The Journal of Investigative Dermatology, 143(6), 1042-1051.e3.

+ Open protocol

+ Expand

pLKO1 Lentiviral Transduction Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pLKO1 plasmid, pLenti entry-destination system,^{57 (link)} and helper vectors, VSVG and delta8.2, were purchased from Addgene. Virus packaging and target cell infection were performed following standard protocols from Addgene. Stable cell lines were created by selection with 1 μg/ml puromycin (P9620, Sigma) for 6 days.

Zeng W., Zhang J., Qi M., Peng C., Su J., Chen X, & Yuan Z. (2014). αNAC inhibition of the FADD-JNK axis plays anti-apoptotic role in multiple cancer cells. Cell Death & Disease, 5(6), e1282-.

+ Open protocol

+ Expand

Generating OVA-expressing UPK10 cells via lentiviral transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols

The lentiviral constitutive expression vector pLV-EF1a- OVAdeltaN-2A-IRES-blast was created by cloning chicken ovalbumin lacking the sequence coding for amino acids 1-49 from the vector pcDNA3-deltaOVA (Addgene 64595) into the pLV-EF1a IRES-blast vector backbone (Addgene #85133) using 5′ EcoRI and 3′ HpaI restriction sites by using standard techniques. UPK10 cells were transduced to express OVA using the packing cell line HEK293T and the packaging plasmid, VSVG (Addgene #14888) and Delta 8.2 (Addgene # 12263), (following the JetPRIME reagent protocol). Two days after transduction, UPK10 cells expressing OVA were selected under Blasticidin (6ug/mL). UPK10-OVA^low expressing cells were sorted after staining with the PE anti-mouse H-2Kb bound to SIINFEKL. Sorted fractions were further expanded in R10 supplemented with Blasticidin (6ug/mL).

Chaurio R.A., Anadon C.M., Costich T.L., Payne K.K., Biswas S., Harro C.M., Moran C., Ortiz A.C., Cortina C., Rigolizzo K.E., Sprenger K.B., Mine J.A., Innamarato P.P., Mandal G., Powers J.J., Martin A., Wang Z., Mehta S., Perez B.A., Li R., Robinson J., Kroeger J.L., Curiel T.J., Yu X., Rodriguez P.C, & Conejo-Garcia J.R. (2022). TGF-β-mediated silencing of the genomic organizer SATB1 promotes Tfh cell differentiation and formation of intra-tumoral tertiary lymphoid structures. Immunity, 55(1), 115-128.e9.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!