α 32p cordycepin 5 triphosphate

Detection of passenger strand cleavage was performed as described (Matranga et al. 2005 (link)) with the following modifications: The 3′ end of the passenger strand was radiolabeled by [α-³²P] cordycepin-5′-triphosphate (PerkinElmer) and yeast poly(A) polymerase (Thermo Fisher Scientific), while the 5′ end of the guide strand was nonradioactively monophosphorylated. Typically, in 20 µL reactions, 2 µL of siRNA duplexes were incubated at 25°C with 10 µL of lysate from HEK293T cells overexpressing FLAG-tagged Ago2, 2 µL of 1 µM 2′-O-methyl oligonucleotide complementary to the passenger strand, and 6 µL of 40× reaction mix. An amount of 2 µL of the reaction mixture was taken at each time point, mixed with 8 µL of low-salt PK solution, and incubated at 55°C for 10 min. An equal volume of 2× formamide dye was then added and incubated at 68°C for 5 min. The 3′ cleavage fragments of the passenger strand were analyzed on an 15% denaturing polyacrylamide gel. Gels were dried and imaged by Typhoon FLA 7000 (GE Healthcare Life Sciences) and quantified using MultiGauge software (Fujifilm Life Sciences). Graphs were prepared using IgorPro (WaveMetrics).

Oligonucleotides purified by polyacrylamide gel electrophoresis were purchased from Eurogentec. The 70 bp quadruple-blocked substrates were generated by labeling the 3′ end of PC210 (GTAAGTGCCGCGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCATGCATC) and annealing to PC211 (GATGCATGAGGTGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCACCGCGGCACTTAC). The biotin labels were attached to internal thymidines (in bold). The labeling reaction was carried out using terminal deoxynucleotidyl transferase (New England Biolabs) and α-³²P cordycepin 5′ triphosphate (Perkin Elmer) (43 (link)). For the DNA2 stimulation assays, HindIII digested λ DNA (New England Biolabs) was labeled at the 3′ end with [α-³²P] dATP (Perkin Elmer) and the Klenow fragment of DNA polymerase I (New England Biolabs). Unincorporated nucleotides were removed with Micro Bio-Spin P-30 chromatography columns (Biorad). Subsequently, prior to each experiment, the substrate was heated at 95°C for 5 min to obtain ssDNA (16 ).