3′-UTR regions of LDLR mRNA were cloned into pDEST12.2 (Invitrogen), which contains a 5′-RFP tag. 3′-UTR regions of β-actin mRNA were cloned into pDEST12.2 (Invitrogen), which contains a 5′-LUC2 tag. Human ZFP36, ZFP36L1 and ZFP36L2 open reading frames were cloned into pDEST12.2 (Invitrogen), which contains a 5′-MYC tag or a 5′-Flag tag, or into pDEST15 (Invitrogen).
Pdest12
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PDEST12.2 is a laboratory equipment designed for precision temperature control. It is a compact and versatile device that can be used in various research and testing applications requiring accurate temperature regulation.
Automatically generated - may contain errors
Lab products found in correlation
Dh5 alpha competent cells, by Thermo Fisher Scientific (1 mentions)
Gateway lr clonase enzyme mix, by Thermo Fisher Scientific (1 mentions)
Pdest15, by Thermo Fisher Scientific (1 mentions)
Mcl 1, by Santa Cruz Biotechnology (1 mentions)
Temozolomide tmz, by Interchim (1 mentions)
β tubulin, by Merck Group (1 mentions)
Pcdna dest40, by Thermo Fisher Scientific (1 mentions)
Pentr d topo, by Thermo Fisher Scientific (1 mentions)
5 protocols using pdest12
1
Cloning of mRNA UTRs and ORFs
2
Construction of HPSE1 and HPSE2 Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Construction of the expression vectors was performed according to the standard cloning protocols. The vectors were generated by recombination of pDEST12.2 (Invitrogen) with vectors containing full length HPSE2 and HPSE1 (pENRT223.1_HPSE1, pENRT223.1_HPSE2, MyBioSourse, San Diego, CA, USA). Gateway LR Clonase enzyme mix (Invitrogen) catalysis the in vitro recombination between an entry clone pENTR223.1_HPSE2 and destination vector pDEST12.2 to generate expression clones. Correct clones was selected by PstI (New England Biolabs) digestion and confirmed by sequencing (SeqLab). For all cloning experiments in current work subcloning efficiency DH5 alpha competent cells (Invitrogen) were used accordingly to the standard protocols recommended by the supplier.
3
Temozolomide-Induced Apoptosis and Autophagy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All reagents were from Sigma except for the Temozolomide (TMZ) obtained from Interchim (Paris, France). The stock solution of TMZ in DMSO at 100mM. Aliquots were frozen at −20°C and dilutions to the appropriate concentrations were done in culture medium just before the experiment. The following antibodies were used: Mcl-1 (sc-819 Santa Cruz), Bax (2D2, Sigma), Bak (556396- BD-Pharmingen USA), SQSTM1/p62(5114-Cell Signaling) and LC3B (2775- Cell Signaling), β Tubulin (T0198-Sigma), αActin (clone C4, MAB1501, Millipore). Secondary mouse and rabbit antibodies were from Jackson ImmunoResearch (UK). For MGMT transfection the plasmid pDEST 12.2 was obtained from In Vitrogen, Life technologies (CA) and the MGMT cDNA from ATCC, clone MGC-5186.
4
Antibody Expression Plasmid Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In our previous report (10 (link)), we generated plasmids encoding the genes for the heavy chain (IgG) and the light chain (kappa) of a neutralizing anti-HA antibody (19 (link)) (Data S1 in Supplementary Material). In the current study, all constructions are based on the pCADEST1 vector, which was constructed from pCA5, a CAG promoter-driven plasmid, and pDEST12.2 (Invitrogen) (20 (link)). Mouse IgA, Joining chain, and IgE were cloned from spleen cells. IgM and IgD cDNA were cloned from the mouse B-cell line, WEHI-231. All the sequence data were described in Data S1 in Supplementary Material. Each plasmid vector encoding the anti-HA antibody was constructed by overlap PCR from pCADEST1-anti-HA IgG1 using the primers indicated in Table S1 in Supplementary Material. The plasmids, pCADEST1-anti-HA IgG1, pCADEST1-anti-HA IgA, pCADEST1-anti-HA kappa chain, and pCADEST1-Joining chain were purified by CsCl-ethidium bromide gradient centrifugation (21 (link)). pCADEST1-anti-HA IgM, pCADEST1-anti-HA IgD, and pCADEST1-anti-HA IgE were purified using NucleoBond® kits (Clontech, CA, USA) according to the manufacturer’s instructions.
5
Cloning and Tagging of Human FTSJ1, WDR6, and THADA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNAs of human FTSJ1, WDR6, and THADA were amplified by reverse transcription and PCR from HeLa cells’ total RNA. The primer sequences are as follows: FTSJ1, CACCATGGGACGGACGTCAA (forward) and AGGTGAACAACTCATTTCATTG (reverse); WDR6, CACCATGGGCAGCGCGG (forward) and GTCATACCAGTTGTAAACCTCAAG (reverse); THADA, CACCATGGGTGTAAAGAAGAAGAAAGAAATG (forward) and ACATGCCGCTTCTGTTCTT (reverse). Each amplicon was inserted into a pENTR/D-TOPO (Thermo Fisher Scientific) by directional TOPO cloning and transferred to a modified pDEST12.2 (Invitrogen) with a C-terminal FLAG-tag or a pcDNA-DEST40 (Thermo Fisher Scientific) by Gateway cloning according to the manufacturer’s instruction (Thermo Fisher Scientific).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!