DNA methylation levels were evaluated by COBRA as we previously reported15 (link),16 (link). In brief, sodium bisulfite treatment was performed using an EpiTect Bisulfite kit (Qiagen) according to the conditions as follows: 95 °C for 5 min, 65 °C for 85 min, 95 °C for 5 min and 65 °C for 175 min. After sodium bisulfite treatment, PCR was performed using one unit of Biotaq HS DNA polymerase (Bioline, London, UK) and the primer sets shown in Supplementary Table S11 online under the thermocycling conditions (35 to 38 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, with an initial step of 95 °C for 10 min and a final step of 72 °C for 7 min). A part of the PCR product was digested with the restriction enzyme TaqI (Takara, Tokyo, Japan) or HpyCH4IV (New England Biolabs, Ipswich, MA). The treated PCR product was electrophoresed by 3% agarose gel. PCR products from methylated DNA and unmethylated DNA are digested and undigested by the treatment with the restriction enzyme. The intensity of the signals of the digested and undigested PCR products was measured by densitometry. Methylation levels (%) were calculated as the ratio of the digested PCR product in the total PCR product (digested + undigested products).
Biotaq hs dna polymerase
Manufactured by Meridian Bioscience
Sourced in Japan, United Kingdom
BIOTAQ HS DNA Polymerase is a thermostable DNA polymerase suitable for use in PCR amplification. It exhibits high thermal stability and processivity, enabling efficient DNA synthesis.
Automatically generated - may contain errors
Lab products found in correlation
Ez dna methylation direct kit, by Zymo Research (5 mentions)
Pgem t easy vector, by Promega (5 mentions)
Dneasy blood tissue kit, by Qiagen (4 mentions)
Ampdirect plus, by Shimadzu (3 mentions)
Ez dna methylation gold kit, by Zymo Research (3 mentions)
Hpych4iv, by New England Biolabs (2 mentions)
Bigdye terminator v1.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions)
Qiaquick gel extraction kit, by Qiagen (2 mentions)
Multina, by Shimadzu (2 mentions)
Epitect bisulfite kit, by Qiagen (1 mentions)
Abi prism 3100 avant genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Multina microchip electrophoresis system, by Shimadzu (1 mentions)
S3e cell sorter, by Bio-Rad (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Fastdigest, by Thermo Fisher Scientific (1 mentions)
Genomiphi v2 dna amplification kit, by GE Healthcare (1 mentions)
Blood cell culture dna midi kit, by Qiagen (1 mentions)
Agarose s, by Nippon Gene (1 mentions)
Gelred, by Biotium (1 mentions)
15 protocols using biotaq hs dna polymerase
1
Quantitative DNA Methylation Analysis
2
Quantitative DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was isolated from tissues or cells using DNeasy Blood & Tissue Kit (QIAGEN) according to the manufacture’s instruction. Bisulfite conversion of the DNA was performed using EZ DNA Methylation-Direct Kit (ZYMO Research). Nested PCR was performed using BIOTAQ HS DNA Polymerase (BIOLINE). The sequences of the PCR primer were designed with MethPrimer (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi ) [13 (link)]. The primer sequences are shown in Table 1 . The PCR products were gel-purified, sub-cloned into the pGEM-T Easy vector (Promega), and sequenced using an ABI PRISM 3100-Avant Genetic Analyzer (Applied Biosystems). Sequence data were analyzed with Quantification tool for Methylation Analysis (http://quma.cdb.riken.jp/top/quma_main_j.html ) [14 ]. The data were obtained from two independent experiments.
3
Quantitative DNA Methylation Analysis
4
Bisulfite Sequencing Analysis of Vasa-Venus ESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite sequencing analysis by Sanger sequencing was carried out as described previously [18 (link)]. Max-KD VV3 ESCs with a Vasa-Venus reporter or control ESCs (ESCs transfected with AllStars negative control siRNA) were cultured for approximately 72 h and sorted using an S3e cell sorter (Bio-Rad). Max-KD VV3 ESCs were purified based on Vasa::Venus-positivity, and control ESCs were purified based on Vasa::Venus-negativity. Genomic DNA was extracted from both cell types using a Qiagen DNeasy blood & tissue kit or Qiagen All-prep DNA/RNA micro kit and converted with sodium bisulfite using an EZ DNA methylation-direct kit (Zymo Research) according to the manufacturer’s instructions. The targeted regions were amplified from bisulfite-converted DNAs using BIOTAQ HS DNA Polymerase (Bioline). The sequences of the PCR primers used for this assay are shown in S1 Table . The PCR products were cloned into respective pGEM-T easy vectors (Promega) and sequenced using a BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems).
5
Quantitative Analysis of SNAIL Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of a transcription factor of E‐cadherin, SNAIL, was examined by semiquantitative real‐time polymerase chain reaction (RT‐PCR). The total RNA was isolated by using a RNeasy mini kit (QIAGEN, Tokyo, Japan). The complementary (c)DNA was synthesized from 1 μg of total RNA by using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). The RT‐PCR was performed by using BIOTaq HS DNA Polymerase (BIOLINE, Tokyo, Japan), according to the manufacturer's protocol, with an amplifying primer pair for SNAIL (5′‐ctccctgtcagatgaggacagt‐3′ and 5′‐ tccttgttgcagtatttgcagt‐3′) and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) (5′‐tgcaccaccaactgcttagc‐3′ and 5′‐ ggcatggactgtggtcatgag ‐3′) serving as an internal control. The thermal cycling conditions were 25 cycles (GAPDH) or 32 cycles (SNAIL) of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 15 seconds, with an initial step of 95°C for 10 minutes. The PCR products were electrophoresed on a 2% agarose gel.
6
Rapid Mushroom DNA Extraction for PCR-RFLP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A quick DNA extraction method was used for the PCR-RFLP analysis. Briefly, mushrooms were washed with MilliQ water, and took an approximately 100-mg portion was placed in a 1.5-mL Eppendorf tube. The mushrooms were homogenated using a BioMasher II in 400 μL PrepMan Ultra Sample Preparation Reagent, and incubated at 100 C for 10 min. Then, samples were centrifuged at 13,000 × g for 2 min. The supernatant was used as PCR template for PCR-RFLP. PCR amplification for the ITS region was performed using BIOTAQ HS DNA polymerase (Bioline, London, UK) and primers, ITS1 and ITS4. PCR reaction conditions were the same as those in Fungal sampling, DNA isolation, PCR, sequencing and dataset assembly section. For restriction endonuclease reaction, purified PCR product was digested using MslI, DdeI, or a combination of HaeIII and HincII (10U per 1 μg PCR product; FastDigest, ThermoFisher Scientific, MA, USA) for 5 min to 30 min at 37 °C, and the digested product was run on a 3% agarose gel in TAE buffer.
7
Molecular Confirmation of Tsetse Fly Species
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For molecular confirmation of the tsetse fly species, GlossinaITS1_for (5′-GTG ATC CAC CGC TTA GAG TGA−3′) and GlossinaITS1_rev (5′-GCA AAA GTT GAC CGA ACT TGA−3′) primers were used to amplify the ITS1 region of ribosomal genes of tsetse flies (46 (link)). Reactions contained 1–10 ng of template DNA, 1 × Ampdirect Plus (Shimadzu Corp., Kyoto, Japan), 0.25 U BioTaq HS DNA Polymerase (Bioline, Memphis, TN, USA), 0.2 mM primers, and distilled water to a total volume of 10 μL. Amplification included an initial denaturation step at 95°C for 10 min, followed by 30 cycles each of 94°C for 30 s, 62°C for 1 min, 72°C for 2 min, and a final extension step at 72°C for 7 min. The band patterns were visually inspected after gel electrophoresis (G. pallidipes: 920 bp, G. m. centralis: 800 bp and 150 bp). There was a total of 212 G. pallidipes and 86 G. m. centralis samples.
8
Yellowtail Linkage Map Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA extracted from hybrid cells was expanded by whole genome amplification using a GenomiPhi V2 DNA Amplification Kit (GE Healthcare, Buckinghamshire, UK). PCR was performed on 60 ng of amplified DNA using BIOTaq HS DNA Polymerase (Bioline, London, UK) in a final volume of 15 μL. Microsatellite DNA markers were used to genotype the 94 markers mapped in the yellowtail linkage map [2, unpublished observations]. Amplification was performed over 40 cycles: 30 s at 95°C, 10 s at 62°C, and 30 s at 72°C, in addition to a 10-min pre-dwell at 95°C and a 3-min post-dwell at 72°C. The PCR products were analyzed by electrophoresis in a 2% agarose gel, and were scored as present, absent, or ambiguous. After analysis of the retention profiles of the 94 microsatellite markers in each cell line, a total of 93 RH cell lines were selected for the RH panel. Each cell line within the RH panel was cultured to confluence in two 75 cm2 dishes, yielding 1 × 107 cells. Then, genomic DNA from each cell line was extracted using the Blood & Cell Culture DNA Midi Kit (Qiagen, Hilden, Germany).
9
Molecular Detection of T. b. rhodesiense
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SRA PCR was employed to identify T. b. rhodesiense using the primers described by Radwanska et al. [47 (link)] (Supplementary Table 2 ). Reagents used for each reaction included 5 μL Ampdirect plus (Shimadzu, Japan), 0.05 μL BIOTAQ HS DNA Polymerase (5 U/μL) (Bioline, UK), 0.2 μL of each 10 mM primer, 2.55 μL RNase-free water, and 2 μL extracted DNA. The temperature and cycling profile included an initial hold for 10 min at 95 °C, followed by 40 cycles at 94 °C for 30 s, 60 °C for 1 min, 72 °C for 1 min, and a final extension at 72 °C for 5 min. PCR products were examined by electrophoresis in 2% agarose S (Nippongene, Japan) in TAE buffer and stained using GelRed (Biotium, USA) dye before being visualized under ultraviolet light.
10
Comprehensive DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted using QIAGEN DNeasy Blood & Tissue kits or QIAGEN All prep DNA/RNA Micro kits and converted with sodium bisulphite using the EZ DNA Methylation-Direct Kit (Zymo Research) according to manufacturer’s instructions. The targeted regions of Dazl, Tex19.1 and Sycp1 were amplified from bisulphite-converted DNAs using BIOTAQ HS DNA Polymerase (BIOLINE). The sequences of the PCR primers used for this assay are listed in Supplementary Table S2 . The PCR products were cloned into respective pGEM-T easy vectors (Promega) and were sequenced using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!