NBP (purity ≥99%) was provided by MedChemExpress (Shanghai, China). HE, safranin O-fast green, and alcian blue staining solutions originated from Solarbio (Wuhan, China). Cell-Counting Kit-8 (CCK-8) was purchased from Dojindo (Kumano, Japan). TRIzol reagent, dimethyl sulfoxide (DMSO), and immunohistochemical staining kit were purchased from Absin (Shanghai, China). Penicillin, streptomycin, 0.25% trypsin, type II collagenase, fetal bovine serum (FBS), and Dulbecco's modified Eagle medium (DMEM) were provided by Gibco (NY, USA).
Trizol reagent
Manufactured by Absin
Sourced in China
TRIzol reagent is a proprietary mixture of phenol and guanidine isothiocyanate used for the isolation and purification of RNA from biological samples. It is a single-step method that effectively isolates total RNA, including small RNAs, from cells and tissues.
Automatically generated - may contain errors
Lab products found in correlation
Sensifast sybr hi rox mix, by Meridian Bioscience (2 mentions)
Thermal cycler, by Bio-Rad (2 mentions)
Gotaq polymerase, by Promega (2 mentions)
Penicillin, by Thermo Fisher Scientific (1 mentions)
Streptomycin, by Thermo Fisher Scientific (1 mentions)
Trypsin, by Thermo Fisher Scientific (1 mentions)
Collagenase type 2, by Thermo Fisher Scientific (1 mentions)
Safranin o fast green, by Solarbio (1 mentions)
Dulbecco s modified eagle medium dmem, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Cell counting kit 8 cck 8, by Dojindo Laboratories (1 mentions)
Alcian blue, by Solarbio (1 mentions)
Sybr green system, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Abi 7500, by Thermo Fisher Scientific (1 mentions)
Taqman one step rt qpcr kit, by Solarbio (1 mentions)
Cdna synthesis kit, by Roche (1 mentions)
Sybr green pcr mastermix, by Solarbio (1 mentions)
Reverse transcriptase, by Promega (1 mentions)
Abi prism 7000 sequence detection system, by Thermo Fisher Scientific (1 mentions)
12 protocols using trizol reagent
1
Detailed Chondrocyte Isolation Protocol
2
HUVEC RNA Isolation and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Trizol reagent (Absin, Shanghai, China) was utilized to isolate RNA from treated HUVECs, followed by converting RNA to cDNA using the Prime Script RT reagent kit (Takara Bio, Shiga, Japan). The SYBR Green system (Applied Biosystems, California, USA) and an ABI 7500 (Applied Biosystems, California, USA) were used to perform the real-time PCR. The normalization of the housekeeping gene β-actin was conducted to calculate the relative expression level of targeted genes, followed by determining the fold changes using the 2−ΔΔCt method.
3
Transcriptional Regulation in Epithelial-Mesenchymal Transition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from tissues was got using Trizol reagent (abs60031, absin, China). Afterward, the qRT-PCR reaction was conducted by TaqMan One-Step RT-qPCR Kit (T2210, Solarbio, China) in an EDC-810 PCR system (Eastwin Life Sciences, Inc.) under the manufacturer’s instructions. β-actin was taken as the normalization control. The 2−ΔΔCT was taken as count the relative expressions of the gene (Sun et al., 2020 (link)). The primers were as follows: E-cadherin forward: 5′-AAAGGCCCATTTCCTAAAAACCT-3′, E-cadherin reverse: 5′-TGCGTTCTCTATCCAGAGGCT-3’; Vimentin forward: 5′-TGCCGTTGAAGCTGCTAACTA-3′, Vimentin reverse: 5′-CCAGAGGGAGTGAATCCAGATTA -3’; Snail forward: 5′-ACTGCAACAAGGAATACCTCAG-3′, Snail reverse: 5′-GCACTGGTACTTCTTGACATCTG-3’; TGF-β1 forward: 5′-CTAATGGTGGAAACCCACAACG-3′, TGF-β1 reverse: 5′-TATCGCCAGGAATTGTTGCTG-3’; AKT forward: 5′-AGCGACGTGGCTATTGTGAAG-3′, AKT reverse: 5′-GCCATCATTCTTGAGGAGGAAGT-3’; GSK3β forward: 5′-GACTAAGGTCTTCCGACCCC--3′, GSK3β reverse: 5′-TTAGCATCTGAGCTCTGCTGT-3’; β-actin forward: 5′-GGAGCGAGATCCCTCCAAAAT-3′, β-actin reverse: 5′-GGCTGTTGTCATACTTCTCATGG-3’.
4
Quantitative Analysis of BHLHE41 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells by the Trizol reagent (abs60031, absin, China), then it was reversely transcribed to cDNA by the cDNA synthesis kit (11483188001, Roche, USA). Then, QRT-PCR was performed by the SYBR Green PCR Mastermix (2×, SR1110, Solarbio, China) in a PCR system (QuantStudio 5, ABI, USA). GAPDH was served as the normalization control. The results were calculated by the 2-ΔΔCt method. The primers were as follows: BHLHE41 forward, 5′-AAGGAGCATGAAACGAGACGA-3′ and reverse, 5′-CTCGGTTAAGGCGGTTAAAGC-3′; GAPDH forward, 5′-TGTGGGCATCAATGGATTTGG-3′ and reverse, 5′-ACACCATGTATTCCGGGTCAAT-3′.
5
Quantitative RNA Expression Analysis in BV2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was separated from BV2 cells using TRIzol reagent (Absin), and total RNA (1 μg) was reverse‐transcribed in a reaction mixture containing 1 U RNase inhibitor, 500 ng random primer, 3 mM MgCl2, 0.5 mM dNTP, 1X RT buffer, and 10 U reverse transcriptase (Promega). The cDNA served as a template for the PCR reaction, which was performed using Go Taq polymerase (Promega) and primers. The RT‐qPCR was carried out on the thermal cycler (Bio‐Rad) and on the ABI PRISM 7000 Sequence Detection System (Applied Biosystems) using Sensi FAST SYBR Hi‐ROX Mix (Bioline). GAPDH was used as an endogenous reference for mRNA detection. Data were calculated using the 2−△△CT method.
31 (link) The experimental operating conditions were 95°C for 10 min, 95°C for 5 s, and 60°C for 60 s for 40 cycles. The primer sequences used in this study are listed in Table1 .
31 (link) The experimental operating conditions were 95°C for 10 min, 95°C for 5 s, and 60°C for 60 s for 40 cycles. The primer sequences used in this study are listed in Table
6
Quantification of Hepatitis E Virus RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol Reagent (Absin, China, abs9331) according to the manufacturer's protocol. After reverse-transcribed into cDNA, HEV RNA was quantitated by SYBR-Green-based RT-qPCR (2X SYBR Green qPCR Master Mix, APExBIO, USA). GAPDH was used as a housekeeping gene to normalize gene expression using the 2−ΔΔCt (ΔΔCt = ΔCTsample-ΔCTcontrol) formula. HEV primers: HEV-F, TTGCCTCCGAGTTAGTCATC; HEV-R, TGCAAAGCATTACCAGACCG. GAPDH primers: GAPDH-F, GTCTCCTCTGACTTCAACAGCG; GAPDH-R, ACCACCCTGTTGCTGTAGCCAA.
7
RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Absin, Shanghai, China) was used to extract total RNA. Then the quantity and quality of the RNA was determined using a SpectraMax Plus 384 enzyme-labeling instrument. Reverse transcription reactions were performed using Prime Script RT Master Mix (Promega) according to the manufacturer’s instructions. In addition, real-time PCR was performed using a LightCycler® 96 Real-Time PCR System (Roche) and SYBR Green PCR kit (Roche). Gene expression was evaluated using the 2−ΔΔCt method and normalized to the housekeeping gene actin beta (ACTB). The sequences of the utilized PCR primers used are listed in Supplementary Table S1 and were purchased from Sangon Biotech (Shanghai).
8
Quantification of Tumor-Associated Immune Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from lung tumor tissues was extracted with TRIzol Reagent (abs9331, Absin, Shanghai, China). Subsequently, cDNA was synthesized and real-time PCR was proceeded by One-step reverse transcription PCR kit (FP313-01, Tiangen, Beijing, China). β-actin was regarded as internal control for quantification of mRNAs. The primer sequences were listed as following: Adgre1 (F4/80) forward, 5’-GCCACGGGGCTATGGGATGC-3’, reverse, 5’-ACCCACAGTGTCCAGGCAAGG-3’; Arg-1 forward, 5’-CTTGCGAGACGTAGACCCT-3’, reverse, 5’-AATCGGCCTTTTCTTCCTTCC-3’; Mrc1 (CD206) forward, 5’-GGAAACGGGAGAACCATCAC-3’, reverse, 5’-GGCGAGCATCAAGAGTAAAG-3’; iNOS forward, 5’-CCTTGGTGAAGGGACTGAGC-3’, reverse, 5’-CAACGTTCTCCGTTCTCTTGC-3’; CD86 forward, 5’-GACCGTTGTGTGTGTTCTGG-3’, reverse, 5’-GATGAGCAGCATCACAAGGA-3’; VEGFA forward, 5’-TTCATGGATGTCTACCAGCGAA-3’, reverse, 5’-CACTCCAGGGCTTCATCGTT -3’; PD-L1 forward, 5’-TGCGGACTACAAGCGAATCACG-3’, reverse, 5’-CTCAGCTTCTGGATAACCCTCG-3’; β-actin forward, 5’-AGGCCCAGAGCAAGAGAGGTATC-3’, reverse, 5’-CGCAGCTCATTGTAGAAGGTGTG-3’.
9
Quantifying COMMD10 Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the cells was extracted using TRIzol reagent (Absin, Shanghai, China), and then the extracted RNA was reverse transcribed into complementary DNA according to the manufacturer's instructions of a reverse transcription kit (TransGen Biotech, Beijing, China) . Subsequently, qPCR was conducted by M5 HiPer Real-Time PCR Super mix (Mei5bio, Beijing, China). Primer sequences used in this study are listed below. COMMD10: forward-5′-GCT GAA GCA TTT GTC AAT ACG TGG-3′, reverse-5′-GCC ATC TGA AGG TTA AGC TGCC-3′; β-actin: forward-5-′CAC CAT TGG CAA TGA GCG GTTC-3′, reverse-5′-AGG TCT TTG CGG ATG TCC ACGT-3′. β-actin was used as an internal control. 2 -ΔΔCT method was used to calculated the relative expression of RNA.
10
Quantifying GPT mRNA Expression in Gastric Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA level of GPT was analyzed by RT-qPCR as previously described[15 (link)]. Total RNA was isolated from various GC cells (AGS, MKN45, MKN28 and HGC27) and the normal immortalized cells (GES1) by using TRIzol reagent (Absin, Shanghai, China), and then the total RNA (1 μg) was reverse transcribed into cDNA using a reverse transcription kit (Sigma-Aldrich). The various primers and Go Taq polymerase (Promega, Beijing, China) were used in the PCR reaction, which used the cDNA as a template. The RT-qPCR was performed on the thermal cycler (Bio-Rad, Richmond, CA, United States) and on the ABI PRISM 7000 Sequence Detection System using Sensi FAST SYBR Hi-ROX Mix (Bioline, London, United Kingdom). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous reference for the mRNA detection. The 2-ΔΔCT method[16 (link)] was used to calculate the data. The experimental setup consisted of 40 cycles of 95 ℃ for 10 min, 95 ℃ for 5 s, and 60 ℃ for 60 s. The primer sequences used were as follows: GPT, forward 5′-GGACTACTACCTGGACGAAGA-3′, reverse 5’-CACATAGCCACCACGAAAC-3’; GAPDH, forward 5′-TCCTGCACCACCAACTGCTTAG-3′, reverse 5′-AGTGGCAGTGATGGCATGGACT-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!