One shot stbl3 chemically competent cells

Lentiviral plasmids encoding shRNA were obtained from Sigma-Aldrich. Each plasmid was transformed into One Shot Stbl3 chemically competent cells (Invitrogen) and purified by ZymoPURE plasmid Maxiprep kit (Zymo research). Lentiviral pseudoparticles were obtained after plasmid transfection of 293FT cells using Lipofectamine 2000 (Invitrogen) or TurboFectin 8.0 Transfection Reagent (Origene). To prepare Vpx-VLPs, 293T cells were co-transfected by Lipofectamine 2000 or TurboFectin 8.0 Transfection Reagent with the 5 μg pMDL-X, 2.5 μg pcRSV-Rev, 3.5 μg X4-tropic HIV Env, and 1 μg pcVpx/myc, as described previously with some modifications^{37 (link),38 (link)}. The medium was replaced after 6–12 h with fresh media with 1X Viral boost (Alstem). The lentivirus or Vpx-VLPs containing media was harvested 72 h after transfection and concentrated 80 times using Lenti-X concentrator (Takara Clontech) or Lenti Concentrator (Origene). LV particles were then resuspended in RPMI 1640 media without serum and stored at −80°C before use. Virus titer was determined by using Jurkat T cells and Lenti-X GoStix Plus (Takara Clontech).

The GFP-ABL1PP plasmid was generated by site directed mutagenesis using the pcDNA-GFP-ABL1 plasmid (Burton et al., 2003 (link)). The mEGFP-YB1 CSD Y72F and mEGFP-YB1 CSD Y99F plasmid were generated using the mEGFP-YB1 CSD-c1 plasmid. The mEGFP-YB1 Y72/99F-c1 plasmid was generated using the mEGFP-YB1-c1 plasmid. PCR amplification was performed using the PfuUltra II Fusion High-fidelity DNA polymerase (Agilent) according to the manufacturer’s instructions. The template DNA was digested using DpnI (NEB) and the remaining DNA was transformed into One Shot Stbl3 chemically competent cells (Thermo Fisher). Primers used for mutagenesis were as follows: ABL1 P249E Forward: tctcccacttgtcgtagttctcggacacaccatagacagtg; ABL1 P249E Reverse: cactgtctatggtgtgtccgagaactacgacaagtgggaga; ABL1 P242E Forward: ggacacaccatagacagtctccttgttgcgctttggggc; ABL1 P242E Reverse: gccccaaagcgcaacaaggagactgtctatggtgtgtcc; YB-1 Y72F Forward: cctgttgatgaaaccaaatccgttccttacattgaacc; YB-1 Y72F Reverse: ggttcaatgtaaggaacggatttggtttcatcaacagg; YB-1 Y99F Forward: acactgcgaaggaacttcctggggttattcttcttt; YB-1 Y99F Reverse: aaagaagaataaccccaggaagttccttcgcagtgt.

For pLKO-shYB1 #2-puro, the shRNA sequence corresponding to YBX1 (GGTTCCCACCTTACTACAT) (Shibata et al., 2013 (link)) was cloned into the pLKO.1-puro backbone. Briefly, sense and anti-sense oligos for respective shRNA sequences flanked by 5′ AgeI and 3′ EcoRI restriction site overhangs were mixed in 1× annealing buffer (100 mM NaCl, 10 mM Tris-HCl, pH 7.4) and annealed by placing in boiling water that was allowed to cool to 25°C. pLKO.1-shNTC-puro (Sigma Mission TRC1 Lentiviral shRNA library) was digested with AgeI-HF (NEB) and EcoRI-HF (NEB) followed by gel purification using the QIAquick Gel Extraction Kit (QIAGEN). Gel-purified vector and annealed oligos were ligated using the Quick Ligation kit (NEB) and subsequently transformed in One Shot Stbl3 chemically competent cells (Thermo Fisher). For the FUW-HER2-pgk-puro construct, HER2 was PCR amplified from the perbB2-ECFP plasmid using primers flanked with a 5′ and −3′ NheI restriction site (Forward: TAAGCAGCTAGCATGGAGCTGGCGGCCTTGTG; Reverse: TGCTTAGCTAGCTCACACTGGCACGTCCAGAC). The PCR product was gel purified. The PCR product and the TetO-FUW-pgk-puro were digested with NheI-HF (NEB) and the backbone was dephosphorylated using Quick CIP (NEB). The digested PCR product and backbone were gel-purified and annealed using T4 DNA ligase (NEB). The ligation product was transformed.