Ribozol reagent

Total RNA was isolated using Ribozol reagent (VWR, Lutterworth, UK). The cDNA was synthesized by RevertAid H Minus Reverse Transcriptase (Life Technologies, Darmstadt, Germany). Either SYBR Green MasterMix (Roche, Basel, Switzerland) or TaqMan Universal PCR MasterMix (Life Technologies, Darmstadt, Germany) were used for quantitative PCR. 18S rRNA and GAPDH served as parallel endogenous controls. The data represent means of three technical triplicates within each independent biological replicate (n = 3). The primer sequences are listed in supplementary Table S2. The relative mRNA expression levels of each gene were calculated using the 2^−ΔΔCT method.

Total RNA was extracted from the quadriceps tissues using Ribozol reagent (VWR Life Science AMRESCO, Radnor, PA, USA). The cDNA was obtained by reverse transcription from total RNA. The PCR was carried out using a PCR thermocycling machine (Thermo Fisher Scientific, Waltham, MA, USA) that followed the primer sequences and annealing temperatures shown in Table 1. The purified PCR product and the loading dye were mixed together, then loaded into the gel and observed using a gel document machine (ImageQuant LAS 500, GE Healthcare Bio-Sciences AB, Uppsala, Sweden). This was followed by a band of RNA expression being analysed using the Image J program. The gene expression levels, including superoxide dismutase 1 (SOD1), catalase (CAT), muscle RING-finger protein-1 (MuRF-1), muscle atrophy F-box (Atrogin-1), mammalian target of rapamycin (mTOR), and peroxisome proliferator-activated receptor co-activator-1α (PGC-1α), were analysed, and β-actin was used as an internal control.

Transcript levels of specific genes were measured by quantitative real-time PCR (qPCR). Total RNA was extracted from larvae using Ribozol reagent (VWR, Canada) according to the manufacturer’s instructions and quantified using a SpectraDrop Micro-Volume microplate (VersaMax, Molecular Devices, USA). One microgram of RNA was treated with DNase I (Thermo Scientific, USA) to remove genomic contamination prior to cDNA synthesis using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA), according to the manufacturer’s protocols. Transcript levels were measured by qPCR in duplicate using gene-specific primers as described previously^{23 (link)}. See^{21 (link)} for primer specific sequences and annealing temperatures.

For total RNA isolation, pre- and post-CRT FFPE non-neoplastic and tumor rectal tissue samples were first deparaffinized with xylene (VWR International, Radnor, PA, USA) in two washing steps at 50°C. The samples were then fully homogenized into fine particles in 100% ethanol using a motor-driven grinder and centrifuged at maximum speed for 5 min. The collected pellet was rehydrated with 95% ethanol for 10 min following a new centrifugation step at maximum speed for 5 min. Then, samples were lysed with 500 μg/mL proteinase K in 100 μL of protease digestion buffer (20 mM Tris–HCl pH 8.0, 1 mM CaCl₂ 0.5% SDS) at 55°C. Total RNA was isolated using Ribozol™ reagent (VWR International, Radnor, PA, USA) according to the manufacturer's instructions and eluted into 20 μL RNase-free water. For a better evaluation of miRNAs quantity in total RNA, the miRNA concentration was determined using Qubit™ miRNA Assay kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA).

Double-stranded RNAs were synthesized using in vitro transcription with T7 RNA polymerase (NEB) following the manufacturer’s instructions with minor modification. The DNA templates for dsRNAs of green fluorescent protein (GFP) (dsGFP) and NfdsRNase (dsNfdsRNase) were PCR-amplified from pGL3-GFP and pET28a-NfdsRNase, respectively. T7 promoter sequences were added to 5′ ends of the primers (Table 1). PCR products were purified by QIAquick^® Gel Extraction Kit (QIAGEN). Each reaction of in vitro transcription contained 1 × RNAPol Reaction Buffer (NEB), 5 mM DTT (NEB), 0.5 mM rNTP (NEB), 1.25 U/μL T7 RNA polymerase (NEB), and 7.5 ng/μL DNA template. Reactions were incubated at 37°C overnight, and then treated by DNase I (NEB) and RNase One (Promega) simultaneously to remove DNA template and single-stranded RNA. dsRNA was purified by Ribozol™ reagent (VWR) following the manufacturer’s instructions. dsRNA concentrations were determined by Nanodrop.

In the populations of whole peritoneal cells or adherent PECs, real-time PCR (RT-PCR) was applied to determine the relative quantities of mRNA. The expression of genes for cytokines IFN-γ, TNF-α, IL-12p40, IL-6, IL-4, TGF-β, and IL-10, transcription factor NF-κB, and macrophage markers arginase 1, FIZZ-1, Ym-1, and iNOS was evaluated in total PECs. Adherent macrophages/monocytes were analyzed for mRNA abundance of transcription factors STAT1, STAT3, and STAT6, IFN-γ receptor (IFN-γR), IL-12p40, and IL-10. Moreover, mRNAs isolated from adherent PECs from infected mice after cultivation with ABZ, ABZ-SO, and DLE were examined for the expression of IFN-γ, IL-12p40, IL-10, arginase 1, iNOS, NF-κB, and IFN-γ receptor as previously described [28 (link)]. Total RNA was extracted from the cell using RiboZol reagent (VWR Life Science, Radnor Corporate Center, Radnor, PA, USA). Quantitative PCR analysis of the relative abundance of mRNA species was determined using the iTaq SYBR green master mix (BioRad, Hercules, CA, USA) on a BioRad CFX thermocycler (BioRad, Hercules, CA, USA). Relative mRNA expression was calculated by comparative quantification cycle (Cq), normalized to housekeeping gene β-actin utilizing the 2^−∆∆Ct method. The list of primers and their sequences are shown in Table S1 (Supplementary Materials).

Total RNA was extracted from BV2 cells using the RiboZol reagent (VWR Life Science) and purified using 5Prime Phase Lock Gel tubes (Qunatabio) before ethanol precipitation. Total RNA (1 µg) was reverse transcribed using oligo(dT)18 primers with the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) according to manufacturer’s instructions. qPCR was performed using 0.6 ng of cDNA per 10 µL of reaction with the Maxima SYBR Green/ROX qPCR Master Mix 2X (Thermo Scientific) on LightCycler 480 (Roche) under the following conditions: 10 min at 95 °C; 40 cycles of denaturation at 95 °C, 15 s, and annealing at 60 °C, 1 min. Primers (Table 1) were validated by melting curve analysis, and reaction efficiencies were confirmed to be within 90–110%. Among the three reference genes tested (ACTB, RPLP0, and ATP5B), RPLP0 was selected for normalization by NormFinder [47 (link)]. Relative gene expression was calculated according to the 2^–∆∆Ct method.Table 1

List of primers used for quantitative real-time PCR analysis

Gene	Primer pair	Sequence (5′ → 3′)
CTSZ	F R	ACCAGGCCGTTATCAACCACA CATCCAGCCTTTCTCACCCCAG
ACTB	F R	GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT
RPLP0	F R	AGATTCGGGATATGCTGTTGGC TCGGGTCCTAGACCAGTGTTC
ATP5B	F R	ACCACCACCAAGAAGGGATCG GGGTCAGTCAGGTCATCAGCA