For the gene activation experiments 500,000 PC-3 cells were co-transfected with a mixture of 1,000 ng of dCas9-DmrA4x fusions plasmids, 500 ng of DmrC-p65 plasmid (Addgene, #104564), and 500 ng of gRNA plasmids (Addgene, #65777) targeting the AR and IRX4 promoter regions (Supplementary Data 1 ) using 20 ul strip with EN-150 program on a Lonza 4-D Nucleofector X Unit with the SF Cell Line Kit (Lonza). Cells were plated into 24 well plates and complete media containing 500 μM A/C heterodimerizer (Takara Clontech) was changed 24 h after transfection. Cells were harvested 36 h post transfection for RNA isolation and gene expression analysis.
Sf cell line kit
Manufactured by Lonza
Sourced in Switzerland
The SF Cell Line Kit is a laboratory equipment product offered by Lonza. It is designed for the culturing and maintenance of suspension-adapted cell lines. The kit provides the necessary components to support the growth and expansion of these cell lines in serum-free media.
Automatically generated - may contain errors
Lab products found in correlation
Dmrc p65 plasmid, by Addgene (3 mentions)
Grna plasmid, by Addgene (3 mentions)
4d nucleofector x unit, by Lonza (3 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
4d nucleofector, by Lonza (2 mentions)
Clonexpress 2 one step cloning kit, by Vazyme (1 mentions)
P2 primary cell kit, by Lonza (1 mentions)
Fugene hd transfection reagent, by Promega (1 mentions)
4d nucleofector unit, by Lonza (1 mentions)
Amaxa 4d nucleofector, by Lonza (1 mentions)
Stemspan, by STEMCELL (1 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Amaxa nucleofector device, by Lonza (1 mentions)
P3 primary cell kit, by Lonza (1 mentions)
10 protocols using sf cell line kit
1
Gene Activation in PC-3 Cells
2
CRISPR/Cas9 and TALEN Transfections
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
293T and A549 cells were maintained at 37°C, 5% CO2 and cultured in DMEM with glutamine supplemented with 10% FCS and 0.5% penicillin/streptomycin (Invitrogen). 293T translocation libraries were prepared by CaPO4 co-transfection in 10cm dishes of either 20µg pX330 or 20µg each pX335 gRNA combinations with 5µg pCMX-eGFP followed by FACS analysis of GFP and DNA isolation 48 hours post-transfection. A549 cells (Courtesy of David Weinstock, Dana-Farber Cancer Institute) were nucleofected with 2µg or 10µg per 2 ×106 cells using the SF cell line kit (Lonza) and the CM130 program. A549 cells were cultured for 48 hours prior to DNA isolation. For Cas9/I-SceI co-expression studies, pX330 gRNA vectors were co-transfected with pHR-I-SceI followed by FACS analysis 48 hours post-transfection. TALEN pairs (previously generated by FLASH asssembly37 (link)) corresponding to ATM and MYC targeting (Addgene plasmids 36805/36806 and 36713/36714 respectively; Keith Joung)37 (link) were co-transfected into 293T using 20µg each—or otherwise indicated—with 5µg pCMX-eGFP and cultured for 48 hours prior to FACS and DNA isolation. In some experiments 293T cells were gamma irradiated with 7Gy 24hrs post-transfection.
3
Generation of MR1 Knockout B16F10 Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate the MR1 knockout B16F10 cell line (B16F10 MR1 sgRNA), 37 pmoles sgRNA (Synthego) and 270 pmoles recombinant Cas9 (IDT) were incubated together for 10 min at room temperature. sgRNA/Cas9 RNPs were electroporated into 3 × 105 B16F10 cells using a Lonza SF Cell line kit and 4D-Nucleofector. MR1 knockout was confirmed via flow cytometric analysis. Two sgRNAs were used for MR1 knockout (G1: CGACAGUGUCACUCGACAGA, G2: AGGUACACUCAGCUGCUAAG). B16F10 non-targeting sgRNA control cell lines were also generated (G1: GCACUACCAGAGCUAACUC).
4
Characterization of SpCas9 Variant Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SpCas9 variant plasmids were amplified from wild-type SpCas9 and Gibson assembled using the ClonExpressII One Step Cloning Kit (Vazyme). The sequences of the primers used to generate Cas9 mutants are listed in Supplementary Table S2 . To generate a reporter vector, a sgRNA targeting sequence was inserted between the puromycin resistance gene and eGFP in a PiggyBac transposon vector, resulting in a frameshift of eGFP. sgRNA with the U6 promoter sequence was cloned into the transposon vector.
HEK293FT cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin at 37°C with 5% CO2. The reporter vector and PiggyBac transposase vector were electroplated into HEK293FT cells to establish a stable reporter cell line under puromycin selection. The SpCas9 plasmid was transfected into the stable cell line using the DS150 program on a Lonza 4-D Nucleofector with the SF Cell Line Kit according to the manufacturer’s protocol. The eGFP signal was detected by flow cytometry 24, 42 and 60 h postelectroporation. To measure the in vivo protein expression level, transfected cells were analyzed by Western blot 60 h post-transfection. The wild-type SpCas9 plasmid was used as a positive control, and the nontransfected cells were used as a negative control.
HEK293FT cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin at 37°C with 5% CO2. The reporter vector and PiggyBac transposase vector were electroplated into HEK293FT cells to establish a stable reporter cell line under puromycin selection. The SpCas9 plasmid was transfected into the stable cell line using the DS150 program on a Lonza 4-D Nucleofector with the SF Cell Line Kit according to the manufacturer’s protocol. The eGFP signal was detected by flow cytometry 24, 42 and 60 h postelectroporation. To measure the in vivo protein expression level, transfected cells were analyzed by Western blot 60 h post-transfection. The wild-type SpCas9 plasmid was used as a positive control, and the nontransfected cells were used as a negative control.
5
Plasmid Transfection Protocols for Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All plasmids used are listed in SI Appendix . Transfections were performed using a 4D-Nucleofector Unit (Lonza), with the P2 Primary Cell Kit for pCAF2 cells and the SF Cell Line kit for AGS cells. AGS cells were additionally transfected with Fugene HD Transfection Reagent (Promega) if high transfection efficiency was not critical.
6
CRISPR/Cas9 Knockout of TRAC in Jurkat Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 48 h of transduction with IDLVs, the Jurkat cells were nucleofected with CRISPR/Cas9 ribonucleoproteins (RNPs) directed to the TRAC of the TCR alpha gene using the CRISPR/Cas9 system, the Amaxa™ 4D-Nucleofector™ protocol, and the SF cell line kit (Lonza, Basel, Switzerland), together with the EO-115 program, according to the nucleofection protocol for Jurkat cells. The Jurkat cells were plated in 48-well plates and gene-editing efficiency was determined by flow cytometry five days after nucleofection.
7
Overexpression of lncNR4A3 in Hematopoietic Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After full characterization of lncNR4A3, we successfully cloned the transcript in pcDNA™3.1 (+) (Invitrogen) expression vector. The lncNR4A3 and empty vector were delivered into k-562, KG1 cells, and CD34+ hematopoietic cells by nucleofection using AMAXA nucleofector device (Lonza, Switzerland) and SF Cell Line Kit (for K-562 and KG1) and P3 Primary Cell Kit (for CD34+cells), (Lonza, Switzerland). 106 cells were nucleofected with 2 µg of vector for K-562 and CD34+ cells and 4 µg for KG1 cells according to the optimized protocol provided by the manufacturer. After nucleofection cells CD34+ cells were resuspended in expansion medium StemSpan™, Stemcell Technologies (supplemented with 10ng/ml of IL3, IL6, FLT3, TPO), or methylcellulose medium (MethoCult™ Stemcell). Nucleofection efficiency was evaluated using 2µg of pmax-GFP and results are shown in Supplementary Results
8
Gene Activation in PC-3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the gene activation experiments 500,000 PC-3 cells were co-transfected with a mixture of 1,000 ng of dCas9-DmrA4x fusions plasmids, 500 ng of DmrC-p65 plasmid (Addgene, #104564), and 500 ng of gRNA plasmids (Addgene, #65777) targeting the AR and IRX4 promoter regions (Supplementary Data 1 ) using 20 ul strip with EN-150 program on a Lonza 4-D Nucleofector X Unit with the SF Cell Line Kit (Lonza). Cells were plated into 24 well plates and complete media containing 500 μM A/C heterodimerizer (Takara Clontech) was changed 24 h after transfection. Cells were harvested 36 h post transfection for RNA isolation and gene expression analysis.
9
Gene Activation in PC-3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the gene activation experiments 500,000 PC-3 cells were co-transfected with a mixture of 1,000 ng of dCas9-DmrA4x fusions plasmids, 500 ng of DmrC-p65 plasmid (Addgene, #104564), and 500 ng of gRNA plasmids (Addgene, #65777) targeting the AR and IRX4 promoter regions (Supplementary Data 1 ) using 20 ul strip with EN-150 program on a Lonza 4-D Nucleofector X Unit with the SF Cell Line Kit (Lonza). Cells were plated into 24 well plates and complete media containing 500 μM A/C heterodimerizer (Takara Clontech) was changed 24 h after transfection. Cells were harvested 36 h post transfection for RNA isolation and gene expression analysis.
10
CRISPR/Cas9 and TALEN Transfections
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!