Advantage hd polymerase

Manufactured by Takara Bio

Sourced in United States

Advantage HD Polymerase is a high-performance DNA polymerase designed for efficient and reliable PCR amplification. It exhibits enhanced thermostability and sensitivity, enabling robust and consistent results across a wide range of applications.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

HD polymerase (10 citations)

9 protocols using advantage hd polymerase

Generating Translational Fusions of ZmTK-GFP

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gateway^® vectors were employed to generate translational fusions of ZmTK and green fluorescent protein (GFP), using the primers listed in Supplementary Materials Table S1 and Advantage HD Polymerase (Clontech, Mountain View, CA, USA). The amplified PCR products were cloned into the entry vector, pDONR™221 (Thermo Fisher Scientific, Carlsbad, CA, USA), using BP clonase reaction (Invitrogen, Carlsbad, CA, USA). Then, these entry clones were digested with the restriction enzyme MluI (FD0564, Thermo Scientific, Carlsbad, CA, USA) and DNA fragments were subcloned into the pEarleyGate 103 binary vector to generate GFP fusions driven by the CaMV 35S promoter [29 (link)] by LR clonase reaction (Invitrogen). These constructs were used for complementation of Arabidopsis mutants and to determine subcellular location. Three constructs were generated: a full-length ZmTK fused to GFP (hereafter referred to as 35S::ZmTK-GFP), a 72-aminoacid N-terminal sequence fused to GFP (35S::TpZmTK-GFP) and a 195-aminoacid C-terminal sequence fused to GFP (35S::ZmTKΔ84). The latter fusion lacked the N-terminal signal sequence and 12 amino-acids from the mature protein, including a region from the ATP-binding domain.

Nájera-Martínez M., Pedroza-García J.A., Suzuri-Hernández L.J., Mazubert C., Drouin-Wahbi J., Vázquez-Ramos J., Raynaud C, & Plasencia J. (2020). Maize Thymidine Kinase Activity Is Present throughout Plant Development and Its Heterologous Expression Confers Tolerance to an Organellar DNA-Damaging Agent. Plants, 9(8), 930.

+ Open protocol

+ Expand

Catsup Transcript Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each species, we prepared total RNA (Trizol, Invitrogen, Life Technologies GmbH, Germany) and synthesized cDNA (SuperScript III First-Strand Synthesis System, Invitrogen, Life Technologies GmbH, Germany) that was used to amplify Catsup transcript by PCR (Advantage HD Polymerase, Clontech) with specific primers (forward 5′-ATGGCCAAACAAGTGGCTGA-3′ and reverse 5′-TTACTCGAACTTGGCGATAAC-3′). Each PCR product was cloned in pCRII vector (Invitrogen, Life Technologies GmbH, Germany) and at least 10 colonies were picked for plasmid DNA purification and sequencing. These sequences were aligned using MegAlign (DNASTAR) and a consensus sequence was obtained for each species. The sequence of Catsup^In270Del was obtained from the Drosophila Polymorphism Database (DPDB) (Casillas et al., 2005 (link)).

Lavista-Llanos S., Svatoš A., Kai M., Riemensperger T., Birman S., Stensmyr M.C, & Hansson B.S. (2014). Dopamine drives Drosophila sechellia adaptation to its toxic host. eLife, 3, e03785.

+ Open protocol

+ Expand

Identifying Zebrafish NDST Homologs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse NDST protein sequences (Accession id:s NP_032332.2, NP_034941.2, NP_112463.2, NP_072087.1) were used as templates in tblastn searches of the Ensembl Danio rerio database (http://www.ensembl.org). Hits with significantly lower E-values and higher sequence similarity to 3-O-sulfotransferase-2 than to any mouse NDST were regarded as non-relevant. Using this method, five putative ndst zebrafish transcripts were found; ndst1a; ENSDART00000085748, ndst1b; ENSDART00000090213, ndst2a; ENSDART00000125149, ndst2b; ENSDART00000085743, ndst3; ENSDART00000146084.
Primers were designed to amplify the sequences by PCR using Advantage HD polymerase (Clontech; Primer sequences are available upon request). PCR products were cloned into either pENTR/D-TOPO (Invitrogen) vector or pCRII-TOPO vector (Invitrogen). Plasmid DNA was purified with GeneElute plasmid miniprep kit (Sigma) and sequenced using Big Dye v1.1 (Applied Biosystems). Sequences from at least three separate PCR products of each gene were aligned and analyzed using VectorNTI (Invitrogen). Wherever there was a contradiction between the sequences, the “best of three-principle” was applied.

Filipek-Górniok B., Carlsson P., Haitina T., Habicher J., Ledin J, & Kjellén L. (2015). The Ndst Gene Family in Zebrafish: Role of Ndst1b in Pharyngeal Arch Formation. PLoS ONE, 10(3), e0119040.

+ Open protocol

+ Expand

Site-directed mutagenesis of SLX4 to study MSH2 binding

Check if the same lab product or an alternative is used in the 5 most similar protocols

Site-directed mutagenesis for the generation of SLX4^ΔMSH2bd was achieved using the following primers: Fwd 5′ GCAGACCCCGAGCGTTTGAGAC 3′ and Rev 5′ CAATTGTGCTGTGCGGGGTTTG 3′. pENTR1A SLX4 WT was used as a template and PCR was performed with the Advantage HD polymerase (Clontech). The PCR product was then digested by DpnI and subsequently phosphorylated and ligated using T4 PNK and T4 ligase (NEB) before transformation of E. coli DH5α. Clones harboured the expected loss of one AvaII restriction site and the SLX4 insert of one clone was fully sequenced. A gateway LR reaction was then performed to get the pDEST-FRT-TO-FHA and pDEST-FRT-TO-YFP expression vectors of SLX4^ΔMSH2bd.
All the MSH2 constructs and the M453I mutant were obtained through gene synthesis or mutagenesis and cloned in pcDNA3.1(+)-N-eGFP by GenScript. These MSH2 constructs contain a N-terminal SV40 NLS to achieve nuclear localization.
Genomic DNA extraction using 4 × 10⁶ HeLa FITo or HeLa KO30 cells was performed using the DNeasy Blood & Tissue Kit (Qiagen). PCR was performed on 100 ng genomic DNA using PrimeStar GXL SP DNA polymerase (Takara Bio RF220Q) to check exon 3 integrity and plasmid insertion using the following primers:

Guervilly J.H., Blin M., Laureti L., Baudelet E., Audebert S, & Gaillard P.H. (2022). SLX4 dampens MutSα-dependent mismatch repair. Nucleic Acids Research, 50(5), 2667-2680.

+ Open protocol

+ Expand

Lentiviral Synaptophysin-mCherry Overexpression

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

A lentivirus transfer vector, based on a third-generation self-inactivating transfer vector (de Almeida et al. 2001 (link)), was designed to over-express a synaptophysin-mCherry fusion protein. The vector uses the phosphoglycerate kinase-1 promoter which expresses well in rat brain and is primarily neuronal (Krause et al. 2011 (link); Grillo et al. 2015 (link); Myers et al. 2017 (link)). Both rat synaptophysin (Open Biosystems MRN1768–99237971, clone 7936715) and mCherry (Clontech pmCherry-1) cDNAs were amplified by PCR, using primers designed to substitute GTG for the stop codon of the synaptophysin cDNA immediately upstream of the mCherry ATG. The two PCR fragments were cloned into the lentivirus transfer vector using Clontech Advantage HD Polymerase (Mountain View, CA). Viruses were generated by transfection of the transfer vector with three packaging plasmids (Addgene, Cambridge, MA), psPAX2, pRSV-Rev and pMD2.G, into 293T cells. Viruses were concentrated by high-speed centrifugation, purified by further centrifugation through 20% sucrose/Dulbecco’s phosphate buffered saline (DPBS) and stored in 10% sucrose/DPBS at −80°. Virus particle concentrations were determined by quantitative real-time PCR for proviral DNA 24 h following transduction of 293T cells and are expressed as transducing units per microliter (tu/μl).

Wood M., Adil O., Wallace T., Fourman S., Wilson S.P., Herman J.P, & Myers B. (2018). Infralimbic prefrontal cortex structural and functional connectivity with the limbic forebrain: a combined viral genetic and optogenetic analysis. Brain structure & function, 224(1), 73-97.

+ Open protocol

+ Expand

Murine CerS6 Promoter Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols

The putative promoter region of the murine CerS6 was assumed to lie upstream of exon 1 or in exon 1, because the ATG lies in exon 1 (Supplemental 1B). One promotor construct (prom6) from the putative promoter region (Supplemental 1B) of the CerS6 gene was amplified by PCR using genomic DNA from murine BMCs. Primers used for the PCR contained an identification restriction site (Table 1). PCR was performed with Advantage HD Polymerase (Clontech, Mountain View, USA). PCR conditions: 2 min 94 °C, 15 s 94 °C, 20 s 59 °C, 1 min 40 s 72 °C, repeated 34 times, ending with a final 72 °C step for 7 min. The resulting CerS6 promoter PCR products were digested with HindIII and cloned into the pGL3 Basic vector (Promega, Fitchburg, USA) and further designated as prom6.

Kurz J., Barthelmes J., Blum L., Ulshöfer T., Wegner M.S., Ferreirós N., Roser L., Geisslinger G., Grösch S, & Schiffmann S. (2019). Role of ceramide synthase 2 in G-CSF signaling and G-CSF-R translocation into detergent-resistant membranes. Scientific Reports, 9, 747.

+ Open protocol

+ Expand

Engineered Xcc-TALE-trap Vector with Bs3 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

Binary vector pTLAB21 containing the Xcc‐TALE‐trap was modified as follows: avrGf2 gene (Gochez et al., 2015 ) with SacI site was amplified and ligated into vector pK7Bs3_14EBE:avrGf1‐35S‐terminator replacing avrGf1. The Bs3 promoter carrying 14 EBEs was published previously (Shantharaj et al., 2017 (link)). The Bs3_14EBE: avrGf1‐35S‐terminator was amplified with primers ATCCGGAATTCATATGACATGTTC‐TAATAAACGCTCTTTTCT containing EcoRI, NdeI, and reverse primer having EcoRI, ATCCGGAATTCCCAT‐GGCATGCTGGCTCCTTCAACGTTGCGG. The amplicon was ligated into pCR™/GW/TOPO (Life technologies, Carlsbad, California) with EcoRI site. The 35S terminator was amplified with primers GGAATTCCATATGAGTCCGCAAAAATCACCA and GGAATTCCATATGTCACTGGATTTTGGTTT with NdeI site and ligated in front of Bs3_14EBE. Cloned amplicons were amplified using Advantage HD Polymerase (Clontech, Palo Alto, California). Orientation and sequence was verified by Sanger sequencing. The 35S terminator‐ProBs3_14EBE:avrGf2‐35S terminator sequence from pCR™/GW/TOPO was moved into pTLAB21 with EcoRI site. For plant transformation, Agrobacterium strain EHA101 (C58, rif; pTiBo542DT‐DNA, kan) was transformed with plasmid pTLAB21 by electroporation. EHA101 transconjugants were selected on streptomycin 50 mg/mL, kanamycin 50 mg/mL, and rifamycin 25 mg/mL.

Shantharaj D., Minsavage G.V., Orbović V., Moore G.A., Holmes D.R., Römer P., Horvath D.M., Lahaye T, & Jones J.B. (2023). A promoter trap in transgenic citrus mediates recognition of a broad spectrum of Xanthomonas citri pv. citri TALEs, including in planta‐evolved derivatives. Plant Biotechnology Journal, 21(10), 2019-2032.

+ Open protocol

+ Expand

Detecting NPM1 Exon 12 Mutations

Check if the same lab product or an alternative is used in the 5 most similar protocols

The determination of all possible mutations in exon 12 of the NPM1 gene was performed using direct sequencing. Primer sequences were selected and the procedure of sequencing was performed according to Döhner et al.
[21 (link)], except for modified thermal conditions of the first PCR reaction aimed at amplifying the template for sequencing reactions: i. initial denaturation – 95°C 5 min, ii. 35 cycles of 95°C 25 s, 57°C 30 s, 72°C 1 min, iii. final elongation – 72°C 5 min. HD Advantage polymerase (Clontech, USA) was used for PCR. Amplification products were sequenced using an ABI PRISM 3130 Genetic Analyzer.

Koczkodaj D., Zmorzyński S., Michalak-Wojnowska M., Wąsik-Szczepanek E, & Filip A.A. (2016). Examination of the FLT3 and NPM1 mutational status in patients with acute myeloid leukemia from southeastern Poland. Archives of Medical Science : AMS, 12(1), 120-128.

+ Open protocol

+ Expand

Automated Sequencing of NOD2/CARD15 Frameshift

Check if the same lab product or an alternative is used in the 5 most similar protocols

The NOD2/CARD15 frameshift change (3020insC) was analyzed by the use of automated DNA sequencing. The following primers were used to amplify 533 bp:

Forward 5′-CTG AGC CTT TGT TGA TGA GC -3′

Reverse 5′-TCT TCA ACC ACA TCC CCA TT-3′

Each PCR mixture (25 μl) contained 50 ng genomic DNA, PCR buffer (Clontech), dNTP mixture (0.25 mM), HD polymerase (0.31 U) (Clontech), and primers (10 μM of each). The mixture was heated at 94°C for 5 min and underwent 35 cycles of amplification: denaturation at 98°C for 15 s, annealing at 60°C for 10 s, and elongation at 72°C for 20 s. The final elongation takes 5 min at 72°C. The PCR was performed in the Applied Biosystems 9700 Thermal Cycler using the HD Advantage polymerase (Clontech). Sequencing PCR was performed with the use of the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) in a thermal cycler (as described previously). The sequencing PCR product was purified by the use of an exterminator kit (A&A Biotechnology). The sequencing run module was StdSeq50_POP7 in genetic analyzer 3130 (Applied Biosystems). The results were analyzed by the use of Applied Biosystems software (Figure 2).

Zmorzyński S., Popek-Marciniec S., Styk W., Wojcierowska-Litwin M., Korszeń-Pilecka I., Szudy-Szczyrek A., Chocholska S., Hus M, & Filip A.A. (2020). The Impact of the NOD2/CARD15 Variant (3020insC) and PSMA6 Polymorphism (-8C>G) on the Development and Outcome of Multiple Myeloma. BioMed Research International, 2020, 7629456.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!