Total RNAs were extracted by trizol (Invitrogen) and cDNAs were synthetised using Rever Ace qPCR RT Kit (TOYOBO). Real-time PCR was performed using SYBR Green Realtime PCR Master Mix (Roche) and the ABI ViiA7 QPCR System (Applied Biosystems). Chromatin immunoprecipitation (ChIP) was performed to investigate whether EZH2 or/and EZH2 binding to HOXA9 promoter. ChIP assays were performed as described previously (38 (link)). Final analysis was performed using qPCR and shown as fold enrichment of the HOXA9 gene promoter.
Rever ace qpcr rt kit
Manufactured by Toyobo
Sourced in United States, Japan
The Rever Ace qPCR RT Kit is a reagent kit designed for reverse transcription and quantitative real-time PCR (qPCR) analysis. It enables the conversion of RNA to cDNA and subsequent amplification and quantification of target sequences.
Automatically generated - may contain errors
Lab products found in correlation
Abi viia7 qpcr system, by Thermo Fisher Scientific (5 mentions)
Sybr green real time pcr master mix, by Roche (4 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Real time pcr master mix, by Roche (1 mentions)
Magna rip kit, by Merck Group (1 mentions)
Stratagene mx3000p qpcr system, by Agilent Technologies (1 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
Viia7 dx pcr system, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Epitect bisulfite kit, by Qiagen (1 mentions)
All in one mirna qrt pcr reagent kit, by GeneCopoeia (1 mentions)
Faststart universal sybr green master, by Roche (1 mentions)
7 protocols using rever ace qpcr rt kit
1
Analyzing EZH2 Binding to HOXA9 Promoter
2
ChIP-seq Analysis of Transcriptional Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs was extracted by TRIzol (Invitrogen) and cDNAs was synthesized using a Rever Ace qPCR RT Kit (TOYOBO). Real-time PCR was performed using SYBR Green, Real-time PCR Master Mix (Roche) and the ABI ViiA7 QPCR System (Applied Biosystems). ChIP-seq datasets were downloaded from the NCBI SRA website (https://www.ncbi.nlm.nih.gov/Traces/study/?acc=SRP385097&o=acc_s%3Aa ). SRR15838293, SRR15838297, and SRR15838302 were designed to be the input groups, and the experimental group was SRR15838294, SRR15838298, and SRR15838303. All the raw reads were first quality-checked with FastQC 0.11.9 and filtered with trim_galore 0.6.9 (-q 20 –phred 33 –length 20 -e 0.1 -j 4 –stringency 5). Then, the sequences were aligned to the human genome (hg38 assembly) using Bowtie2 and sorted with samtools 1.6. After that, PCR replacements were removed using samtools 1.6. Peaks were then called with MACS2 2.1.0 [23 ] (--nomodel --extsize 300). Data visualization was performed with IGV 2.11.9 software and the ChIPseeker R package 1.32.1 [24 (link)]. ChIP assays were performed with a SimpleChIP® Kit (Agarose Beads) (CST, 22,188 S, Boston, USA) according to the manufacturer’s instructions.
3
Gene Expression and Epigenetic Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All RNA from tissues and cells were extracted with the TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol with modifcation. cDNAs were synthesized using Rever Ace qPCR RT Kit (TOYOBO). Real-time PCR was performed using SYBR Green Realtime PCR Master Mix (Roche) and the ABI ViiA7 qPCR System (Applied Biosystems). Chromatin immunoprecipitation (ChIP) was performed to investigate whether EZH2 and H3K27 binding to p57 promoter. ChIP assays were performed as described previously [26 (link)]. RNA binding protein immunoprecipitation (RIP) experiments were performed using Magna RIP Kit (Millipore, Catalog No.17-701) according to the manufacturer’s instructions and a previously published RIP-Chip protocol [27 (link)]. RIP assays were carried out as described previously [26 (link)]. All primers were in Supplementary Table 1 .
4
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted by Trizol (Invitrogen) and cDNAs were synthetized using Rever Ace qPCR RT Kit (TOYOBO). Real-time PCR was performed using SYBR Green Realtime PCR Master Mix (TOYOBO) and the Stratagene Mx3000P QPCR System (Agilent Technologies). Amplification conditions were as follows: 95°C for 15 s, 60°C for 15 s, 72°C for 45 s for 40 cycles in a 25 μl reaction mix containing 1 × SYBR Green. Primers for the reaction are provided in Supplementary Table S1 .
5
Real-Time PCR Analysis of miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted by trizol (Invitrogen) and cDNAs were synthetised using Rever Ace qPCR RT Kit (TOYOBO). Real‐time PCR was performed using SYBR Green Realtime PCR Master Mix (Roche) and the ABI ViiA7 QPCR System (Applied Biosystems). Amplification conditions were as follows: 95°C for 15 s, 60°C for 15 s, 72°C for 45 s for 40 cycles in a 25‐μl reaction mix containing 1 × SYBR green. The expression levels of miR‐490‐3p and miR‐490‐5p were quantified using stemloop RT according to the manufacturer's protocol (Roche). All reagents for stemloop RT were obtained from Roche and RiboBio. The U6 snRNA was used as an internal control. For miRNA and mRNA PCR, the reactions were incubated in a 96‐well plate at 95°C for 10 min, followed by 40 cycles of 95°C for 20 s, 60°C for 20 s and 72°C for 1 min. The following primers were used for qPCR: PIK3CA‐5′, TGCTAAAGAGGAACACTGTCCA; PIK3CA‐3′, GGTACTGGCCAAAGATTCAAAG; TBP‐5′, TGCACAGGAGCCAAGAGTGAA; TBP‐3′, CACATCACAGCTCCCCACCA.
6
Quantifying TUG1 and miR-194-5p in Bladder Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from bladder cancer tissues or cell lines using TRIzol reagent (Invitrogen, USA) and then reverse transcribed using Rever Ace qPCR RT Kit (TOYOBO, Shanghai), according to the manufacturer’s instructions. Real-time PCR of TUG1 or mRNAs was performed using FastStart Universal SYBR Green Master (Roche, IN, USA) with the ViiA 7 Dx PCR System (Applied Biosystems, USA), while the expression of mature miRNA was determined by PCR with All-in-One miRNA qRT-PCR reagent kit (GeneCopoeia, USA).
Genomic DNA was isolated using QIAamp DNA Mini Kit (QIAGEN), and bisulfite modification of the genomic DNA was carried out using an Epitect Bisulfite Kit (QIAGEN), according to the manufacturer’s instructions. Methylation-specific PCR (MSP) primers for miR-194-5p gene promoter were designed with Methprimer (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi ), using the same methods as Zhou et al.38 (link) Methylation or unmethylation primers for MSP were as follows: methylation, 5′-GGTTATGAGTAGAAGGGGTTGAC-3′ (forward), 5′-TCAATCTTAAACACTATCCGAACG-3′ (reverse); and unmethylation, 5′-GTTATGAGTAGAAGGGGTTGATG-3′ (forward), 5′-CAATCTTAAACACTATCCAAACACC-3′ (reverse).
Genomic DNA was isolated using QIAamp DNA Mini Kit (QIAGEN), and bisulfite modification of the genomic DNA was carried out using an Epitect Bisulfite Kit (QIAGEN), according to the manufacturer’s instructions. Methylation-specific PCR (MSP) primers for miR-194-5p gene promoter were designed with Methprimer (
7
Extraction and Quantification of RNA Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All RNA from tissues and cells were extracted with the TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol with modifications. cDNAs were synthesized using Rever Ace qPCR RT Kit (TOYOBO, Osaka, Japan). Real-time PCR was performed using SYBR Green Real-Time PCR Master Mix (Roche, Basel, Switzerland) and the ABI ViiA7 qPCR System (Applied Biosystems, Foster, CA). Primers were listed as follows: MIAT 5′-TCTTCATGTCAGAACACGCTTTA-3′, 3′-AAGGTCACCCGAGGTCCAA-5′; Loxl2 5′-GGAGAGGACATACAATACCAA-3′, 3′-GTGACATTCTTCATGGGGT-5′; GAPDH 5′-CCTTCATTGACCTCAACTACA-3′, 3′-GCTCCTGGAAGATGGTGAT-5′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!