Lightcycler 480 instrument 2 system

One-hundred percent confluent MGCs were incubated with 3-, 30-, 70-, or 140-µM RSV for 6 hours following the previous study protocol,⁴⁰ as well as cell viability assay. Total RNA was extracted from cultured MGCs using an illustra RNAspin Mini RNA Isolation Kit (GE Healthcare, Amersham, UK). cDNA was synthesized from 1 µg total RNA using the ReverTra Ace (Toyobo Co., Osaka, Japan) according to the manufacturer's instructions. Semiquantitative PCR was performed using KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems, Inc., Boston, MA, USA), and a Roche LightCycler 480 Instrument II system was used to detect the gene expression of BDNF. We used a β-actin primer as a normalization factor that was commercially purchased (Qiagen, Hilden, Germany). The amplification schedule was as follows: initial denaturation at 95°C, followed by 45 cycles of 95°C for 30 seconds, 55°C (BDNF and β-actin) for 1 minute, and 72°C for 30 seconds. The following primer sequences were used: BDNF forward, 5′-ctgagcgtgtgtgacagtatt-3′, and reverse, 5′-ctttggataccgggactttctc-3′ (GenBank accession number: NM_001316310.1). The relative change in mRNA expression was calculated using ΔΔCT values, and each experiment was performed in triplicate. Levels were normalized to those of β-actin and reported as fold change compared with the controls.

Serum HBV DNA/RNA were copurified with QIAamp MinElute Virus kit (Qiagen, Hilden, Germany) from 200 μL of patient serum. Eluted DNA/RNA mixture was subjected to PCR (Quantabio, Beverly, MA) for DNA analysis by a pair of pan‐genotype primers covering the reverse transcriptase region, RT_s: 5′‐CTGCTGGTGGCTCCAGTT‐3′ ‐ and RT_as: 5′‐GCCTTGTAAGTTGGCGAGAA‐3′‐. HBV RNA was purified following a subsequent digestion with 1 U of DNase I (Thermo Fisher Scientific, Waltham, MA) for 30 minutes at 37°C to eliminate HBV‐DNA contamination. To ensure that no residual HBV DNA existed after DNase I digestion, all the DNase I–treated samples were confirmed to be negative by subsequent PCR analysis to prove that residual serum DNA was eliminated completely (Supporting Fig. S1). The reverse‐transcriptase region of serum HBV RNA was amplified by RT‐PCR using the qScript XLT one‐step RT‐PCR kit (Quantabio). HBV DNA in plasma samples were quantified by the Roche COBAS TaqMan HBV Test. Serum HBV RNA was quantified by one‐step reverse‐transcription RT‐qPCR in a LightCycler 480 Instrument II system (Roche, Mannheim, Germany) with the TaqMan probe method as described.⁽³⁰⁾