Human PNKD (L) cDNA was cloned from cDNA ORF Clone (RC206179) (Origene, MD) and was inserted into the pcDNA4/TO vector. By PCR, a FLAG tag or a Myc tag was added to the PNKD (L) cDNA sequence as shown: 5’-FLAG-PNKD-3’ or 5’-PNKD-Myc-3’. To express human RIMS1α, RIMS1 transcript variant 1, cDNA ORF Clone (RC213013) (Origene, MD) was used. The expression of GFP cloned into the pcDNA4/TO vector monitored transfection efficiency. To transfect neurons plated on poly-L-ornithine/laminin/fibronectin-coated 12mm coverslips, we used Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, MA). To transfect 293FT (Thermo Fisher Scientific, MA) cells plated in 10cm dishes, we used 1mg/ml PEI solution (Sigma-Aldrich, MO). A room temperature mixture of plasmids, transfection reagents and Opti-MEM reduced-serum medium were added to the cultures. Two days later, cells were collected for RNA extraction, or lysed in protein lysis buffer or fixed for immunocytochemistry.
Orf clone
Manufactured by OriGene
Sourced in United States
The ORF Clone is a pre-made plasmid containing a full-length open reading frame (ORF) of a specific gene. It provides a convenient source of the target gene sequence for various applications in molecular biology research.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (4 mentions)
Lb medium, by Beyotime (3 mentions)
Pgl3 basic vector, by Promega (3 mentions)
Pei solution, by Merck Group (2 mentions)
Rapamycin, by Merck Group (2 mentions)
A769662, by Apexbio (2 mentions)
Human nmt1 sirna and control sirna, by Santa Cruz Biotechnology (2 mentions)
Human ampkα sirna and control sirna, by Santa Cruz Biotechnology (2 mentions)
Ml265, by Santa Cruz Biotechnology (2 mentions)
Lysosome enrichment kit for cultured cells, by Thermo Fisher Scientific (2 mentions)
Nucleofection kit, by Lonza (2 mentions)
Free fatty acid quantification assay kit, by Abcam (2 mentions)
Shikonin, by Santa Cruz Biotechnology (2 mentions)
Compound c, by Cayman Chemical (2 mentions)
Metformin, by Merck Group (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Sodium pyruvate, by Merck Group (1 mentions)
11 protocols using orf clone
1
Cloning and Transfection of PNKD and RIMS1
2
Cloning and Transfection of PNKD and RIMS1
3
Beiging and MEK6 Overexpression in 3T3-L1 Adipocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the beiging process, 50 nM triiodotyronine (T3) was added into the growth medium for 2 days, and the medium for beiging (10% FBS-DMEM, 10 ug/mL insulin, 0.5 uM IBMX, 50 nM T3, and1 uM rosiglitazone) was changed every 2 days for 8 days. BLA was confirmed by UCP-1 protein expression [19 (link)]. For the MEK6 transfection, MEK6 DNA (NM_011943) mouse tagged ORF Clone (MG204942, Origene, Rockville, MD, USA) was transfected in the competent bacteria, and plasmid DNA was isolated by pDNA purification kit (Cosmogentech, Seoul, Republic of Korea). A classic, highly effective method of Lipofectamine 3000 reagent, was used for the MEK6 for over-expression in adipocytes [20 (link)]. 3T3-L1 cells (3 × 105 cells/well in 6 well-plate) were cultured for 24 h at 37 °C in 5% CO2 until they reached confluence. The DNA mixture was made with Lipofectamine 3000 reagents, p3000 reagent, opti-MEM, and DNA solution. The DNA mixture was activated for 15 min at room temperature and then dropped in to the 3T3-L1 cells. The cells were incubated for 3–4 h at 37 °C in 5% CO2. After activation, antibiotics free medium was added to the cells; before culturing them under the same conditions. Transfection of MEK6 was confirmed by the mRNA(real-time PCR) and protein expression (western blotting).
4
Cyclophilin A Cloning and Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cyclophilin A coding region was amplified from the PPIA (NM_021130) human cDNA ORF Clone (Origene, Rockville, MD, USA) using Phusion High‐Fidelity DNA polimerase (New England BioLabs, Beverly, MA, USA) with primer sets 5′‐GAGGGATCC ATGGTCAACCCCACCGTGTTCTTCG‐3′ (forward) and 5′‐GCGACGCGGCCGC AATTTATTCGAGTTGTCCACAGTCAG‐3′ (reverse). The forward and reverse primers harbored a recognition sites of BamHI (underlined) and NotI restriction endonucleases, respectively. The PCR reaction was performed as it was described before 43 . After the cleavage of PCR product by BamHI and NotI, it was ligated into pGEX‐4T‐3 plasmid (Addgene, Cambridge, MA, USA).
5
AMPK Modulators and Metabolite Assays
6
AMPK Modulators and Metabolite Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The AMPK activator A769662 was purchased from APExBIO. The AMPK activator metformin, the mTORC1 inhibitor rapamycin and the metabolite succinate were obtained from Sigma-Aldrich. The fatty acid synthase (FAS) inhibitor C75 and the AMPK inhibitor Compound C were purchased from Cayman Chemical. The PFKFB3 inhibitor 3PO was from EMD Millipore. The human NMT1 cDNA ORF Clone and the appropriate control were purchased from Origene. Human NMT1 siRNA and control siRNA, human AMPKα siRNA and control siRNA, the pyruvate kinase M2 (PKM2) activator ML265, the PKM2 inhibitor Shikonin, the metabolites pyruvate and malic acid, were bought from Santa Cruz Biotechnology. Nucleofection kits from Lonza were used for cell transfections. Lysosomes were isolated with the Lysosome enrichment kit for cultured cells (Thermo Fisher Scientific). Concentrations of cellular free fatty acids were determined with the Free Fatty Acid Quantification Assay Kit (Abcam). All reagents were used according to the manufacturers’ instructions.
7
Overexpression and Knockdown of NLN in AML Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For experiments overexpressing NLN, the human NLN open reading frame (ORF) clone (OriGene, no. RC212447) was subcloned into the pLentiEF1 vector (carrying the blasticidin antibiotic resistance gene), and a STOP codon was added at the end of the ORF so that the vector would express NLN without a tag (pLentiEF1-hNLN).
The empty vector, pLentiEF1, served as a control. OCI-AML2 cells were seeded in T25 flasks at 5 × 10 5 cells/ml (3 ml per flask). The culture was supplemented with protamine sulfate (1 g/ml). To each flask, we added 1 ml of either pLentiEF1 or pLentiEF1-NLN viral stock, followed by overnight incubation (37°C, 5% CO 2 ). The following day, 1 ml of virus containing shRNA targeting a control sequence (GFP) or the 3′ UTR of NLN was added and incubated overnight. The next day, cells were resuspended in 20 ml of medium containing both blasticidin (10 g/ml) and puromycin (1.5 g/ml), incubated for 3 days, and then subcultured at a concentration of 1:20 in 20 ml of fresh medium containing blasticidin (10 g/ml) and puromycin (1.5 g/ml) for 3 days. Cells were then subcultured at a concentration of 2 × 10 4 cells/ml in fresh medium with blasticidin (10 g/ml) for 5 days. Cells were collected for immunoblot lysate and seeded at a concentration of 1 × 10 5 cells/ml in fresh medium and counted over 4 days.
The empty vector, pLentiEF1, served as a control. OCI-AML2 cells were seeded in T25 flasks at 5 × 10 5 cells/ml (3 ml per flask). The culture was supplemented with protamine sulfate (1 g/ml). To each flask, we added 1 ml of either pLentiEF1 or pLentiEF1-NLN viral stock, followed by overnight incubation (37°C, 5% CO 2 ). The following day, 1 ml of virus containing shRNA targeting a control sequence (GFP) or the 3′ UTR of NLN was added and incubated overnight. The next day, cells were resuspended in 20 ml of medium containing both blasticidin (10 g/ml) and puromycin (1.5 g/ml), incubated for 3 days, and then subcultured at a concentration of 1:20 in 20 ml of fresh medium containing blasticidin (10 g/ml) and puromycin (1.5 g/ml) for 3 days. Cells were then subcultured at a concentration of 2 × 10 4 cells/ml in fresh medium with blasticidin (10 g/ml) for 5 days. Cells were collected for immunoblot lysate and seeded at a concentration of 1 × 10 5 cells/ml in fresh medium and counted over 4 days.
8
NCKAP1 Expression Modulation in HeLa and iMG Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa cells were cultured in Dulbecco’s MEM containing 10% FBS, sodium bicarbonate, sodium pyruvate (Sigma-Aldrich), and antibiotics. HeLa cells were transfected with green fluorescent protein (GFP)-tagged human NCKAP1 cDNA or NCKAP1 shRNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. iMGs were transduced with pLenti-C-mGFP-Human NCKAP1 (NM_013436), the cDNA ORF Clone (OriGene Technologies, Rockville, MD, USA), or pGFP-C-shLenti-NCKAP1 Human shRNA lentiviral particles (ID 10,787) according to the manufacturer’s protocol. After transfection, cells were assessed by western blotting and RT-qPCR as previously described [32 (link)]. Antibody and primers information are shown in Supplemental Table 3 .
9
Mutagenesis and Cloning of SRF Transcription Factor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SRF open reading frame (ORF) clone was purchased from OriGene Technologies (Catalog No: SC118177). Primers for site-directed mutagenesis (Mut-G274D forward/reverse and Mut-G294C: forward/reverse) were designed online (https://www.genomics.agilent.com/primerDesignProgram.jsp) (Table 2), and PCR amplification products were digested using DpnI (NEB, Catalog: R0176S) before being transfected into DH5α and cultured on ampicillin dishes at 37°C for 14h. Selected successful mutant colonies were grown in 120ml LB medium (Beyotime, ST158), and then plasmids were extracted from the bacteria solution.
To construct the SRFluc reporter plasmid, the genomic sequence of SRF was obtained from the NCBI (https://www.ncbi.nlm.nih.gov/). A fragment beginning approximately 1.2kb upstream of the transcription initiation site of SRF was amplified (sense-primer:
) from the DNA of a healthy individual and was cloned into the pGL3-basic vector (Promega, USA) between the KpnI and HindIII sites. The atrial natriuretic factor (ANF) promoter plasmid was a kind gift from Professor Mona Nemer [28] . The full-length cDNAs for GATA4 expression constructs in the pcDNA3.1(+) vector were previously generated in our laboratory [29] . All plasmid DNA was confirmed and Sanger sequenced by the Beijing Genomics Institute (BGI) in China.
To construct the SRFluc reporter plasmid, the genomic sequence of SRF was obtained from the NCBI (https://www.ncbi.nlm.nih.gov/). A fragment beginning approximately 1.2kb upstream of the transcription initiation site of SRF was amplified (sense-primer:
) from the DNA of a healthy individual and was cloned into the pGL3-basic vector (Promega, USA) between the KpnI and HindIII sites. The atrial natriuretic factor (ANF) promoter plasmid was a kind gift from Professor Mona Nemer [28] . The full-length cDNAs for GATA4 expression constructs in the pcDNA3.1(+) vector were previously generated in our laboratory [29] . All plasmid DNA was confirmed and Sanger sequenced by the Beijing Genomics Institute (BGI) in China.
10
Mutagenesis and Cloning of SRF Transcription Factor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SRF open reading frame (ORF) clone was purchased from OriGene Technologies (Catalog No: SC118177). Primers for site-directed mutagenesis (Mut-G274D forward/reverse and Mut-G294C: forward/reverse) were designed online (https://www.genomics.agilent.com/primerDesignProgram.jsp) (Table 2), and PCR amplification products were digested using DpnI (NEB, Catalog: R0176S) before being transfected into DH5α and cultured on ampicillin dishes at 37°C for 14h. Selected successful mutant colonies were grown in 120ml LB medium (Beyotime, ST158), and then plasmids were extracted from the bacteria solution.
To construct the SRFluc reporter plasmid, the genomic sequence of SRF was obtained from the NCBI (https://www.ncbi.nlm.nih.gov/). A fragment beginning approximately 1.2kb upstream of the transcription initiation site of SRF was amplified (sense-primer:
) from the DNA of a healthy individual and was cloned into the pGL3-basic vector (Promega, USA) between the KpnI and HindIII sites. The atrial natriuretic factor (ANF) promoter plasmid was a kind gift from Professor Mona Nemer [28] . The full-length cDNAs for GATA4 expression constructs in the pcDNA3.1(+) vector were previously generated in our laboratory [29] . All plasmid DNA was confirmed and Sanger sequenced by the Beijing Genomics Institute (BGI) in China.
To construct the SRFluc reporter plasmid, the genomic sequence of SRF was obtained from the NCBI (https://www.ncbi.nlm.nih.gov/). A fragment beginning approximately 1.2kb upstream of the transcription initiation site of SRF was amplified (sense-primer:
) from the DNA of a healthy individual and was cloned into the pGL3-basic vector (Promega, USA) between the KpnI and HindIII sites. The atrial natriuretic factor (ANF) promoter plasmid was a kind gift from Professor Mona Nemer [28] . The full-length cDNAs for GATA4 expression constructs in the pcDNA3.1(+) vector were previously generated in our laboratory [29] . All plasmid DNA was confirmed and Sanger sequenced by the Beijing Genomics Institute (BGI) in China.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!