Q5 site directed mutagenesis system

Recombinant E. coli expression plasmid pET15b-His-TDP-43 2C which codes for carboxyl terminal aa: 193-414 of TDP-43, was a kind gift of Prof. Yoshiaki Furukawa, Keio University, Japan [30] . A familial ALS-linked missense point mutation (A315T) containing mutant TDP-43 2C expressing plasmid was generated using Q5 site-directed mutagenesis system (NEB, USA) using the pET15b-His TDP-43 2C plasmid as the template. The respective forward and reverse primers used for the mutagenesis were: 5'CTTTGGTACCTTCAGCATTAATCCAGCCATGATGGCTGCCGC 3' and 5'ATGCTGAAGGTACCAAAGTTCATCCCACCACCCATATTACTAC-3'. These primers were designed to incorporate a KpnI restriction enzyme recognition site (GGTACC). After DpnI digestion of the template DNA, the PCR product was transformed into competent DH5α E. coli cells (Invitrogen, USA). Then, plasmids were isolated from the obtained transformants and analyzed for positive KpnI digestion to ascertain for the successful mutagenesis.

The HEK293T cell line, pcDNA3-MLH1, and pSG5-PMS2 have previously been described [26] . The Q5 Site directed mutagenesis system (New England Biolabs, Frankfurt, Germany) was used to generate missense variants with appropriate primes according to the manufacturer's protocols. Direct sequencing was used to confirm all of the plasmids that were created [14].
HEK293T cells were transfected as previously described [28] . In brief, at 50-70% confluence, HEK293T cells were transiently transfected in 10 cm round dishes with expression plasmids (1 g/ml, respectively) using 10 l/l of the cationic polymer polyethylenimine (Polysciences, Warrington, PA; stock solution 1 mg/ml). Cells were prepared for confocal laser scanning microscopy or protein extraction after 48 hours [25, 27, 28] .
The extracts were examined using SDS-PAGE and immunoblotting with anti-MLH1, G168-728 from BD Biosciences, as well as anti-PMS2, E-19, and anti-beta-Actin, C2 from Santa Cruz Biotechnologies. A Fuji LAS-4000 mini camera and Multi Gauge v3.2 were used to detect and quantify chemiluminescence signals (Immobilon, Millipore) [14] .

Plasmids used are listed in Supplementary methods. Cloning, expression and purification of full length Hel308 from Methanothermobacter thermautotrophicus (Mth) was as described in (20) . Amino acid sequences identified as forming WHDs of Methanothermobacter and human Hel308/HelQ are defined in Supplementary Table 2, predicted from sequence alignments against known Hel308 crystal structures and using Phyre2 (26) . The DNA sequences encoding these WHDs were synthesized and delivered in plasmids by GeneArt (Life Technologies) with codons optimized for protein expression in E. coli. Coding sequences were sub-cloned from these constructs into pET14b for expression of Nterminally hexahistidine (His)6 tagged WHDs. The Q5 site-directed mutagenesis system (New England Biolabs) was used to generate mutations, sequence deletions or insertions for all of the amino acid alterations to the WHD described. The recQ helicase gene was cloned as described in (5) , for use in genetic analysis.
Mth and human WHD proteins were expressed and purified in the same way. E. coli strain BL21 AI was used to produce each WHD, using the method described for full length Mth