Primescript rt pcr reagent kit

Total RNA was isolated from indicated cells using TRIzol reagent (Takara Bio, Dalian, China) and subsequently used for reverse transcription with a PrimeScript RT‐PCR reagent kit (Takara Bio). cDNA was subjected to real‐time quantitative polymerase chain reaction (RT‐qPCR) with an SYBR Green PCR kit (Takara Bio) on an ABI7500 Real‐time PCR system (Applied Biosystems, Inc., Austin, TX, USA). The primer sequences used in this study were shown as follows: SF3B1‐F, 5′‐GTGGGCCTCGATTCTACAGG‐3′; SF3B1‐R, 5′‐GATGTCACGTATCCAGCAAATCT‐3′; PPP2R5A‐F, 5′‐AGAGCCCTGATTTCCAGCCTA‐3′; PPP2R5A‐R, 5′‐TTTCCCATAAATTCGGTGCAGA‐3′; Myc‐F, 5′‐GTCAAGAGGCGAACACACAAC‐3′; Myc‐R, 5′‐TTGGACGGACAGGATGTATGC‐3′; ACTB‐F, 5′‐ACTCGTCATACTCCTGCT‐3′; ACTB‐R, 5′‐GAAACTACCTTCAACTCC‐3′. The 2‐^ΔΔCt method was used to calculate the relative expression of target genes. The ACTB gene was used as an internal control. For reverse transcriptase polymerase chain reaction (RT‐PCR), the primers used in this study were shown as follows: PPP2R5A‐F, GCCTAGCATTGCAAAACGAT; PPP2R5A‐R, GCAATGCAAAGCCATTGATA.

Total RNA was extracted from treated and untreated cultures using TRIzol reagent according to the manufacturer's protocol (Invitrogen). First-strand cDNA was synthesized using the PrimeScript RT-PCR reagent kit (Takara, China) according to the manufacturer's instructions. The specific primers used for BMP-2 were reverse primer, 5′-TCTCTGTTTCAGGCCGAACA-3′ and forward primer, 5′-TCTGACTGACCGCGTTACTC-3′. β-Actin was amplified as an internal control for normalization. PCR products were separated on 1.5% agarose gels and visualized by ethidium bromide staining, and the images were analyzed by the GEL DOC 2000 system (Bio-Rad, USA), where relative expression level (%) equaled gene band density divided by β-actin band density.

According to the manufacturer's protocol, total RNA was extracted from tissue samples by using Trizol (Invitrogen, Carlsbad, CA) and then converted to cDNA by PrimeScript RT-PCR reagent kit (Takara, Japan). Quantitative analysis was performed on ABI 7500 Real-Time PCR system (Applied Biosystems, USA) using SYBR Green Master Mix (Takara, Japan). Primer sequences are shown below: PTPRH: forward primer: GGCGGCACAACAGAGACTC, reverse primer: CTGTGGCAGTAGTGACAGTCC; GAPDH: forward primer: GGAGCGAGATCCCTCCAAAAT, reverse primer: GGCTGTTGTCATACTTCTCATGG. The relative expression of PTPRH was quantified by using the 2^-Δ∆Ct method. The experiment was conducted in triplicate.