Light cycler 480 2 detection system

qRT-PCR was performed using the Light Cycler 480 II detection system and software (Applied Biosystems, Darmstadt, Germany) with a KAPA SYBR FAST Light Cycler 480 Kit (PeqLab, Erlangen, Germany). The following primers were used: AXIN2: 5′-GCTCAGAGCTTGACCCTGG and 5′- TCATACATCGGGAGCACCGT; HPRT1: 5′-TGACACTGGCAAAACAATGCA and 5′-GGTCCTTTTCACCAGCAAGCT. GLI2: 5′-TCCACACACGCGGAACACCA and 5′- CAGCTGGCTCAGCATGGTCA, HES4: 5′-GTGCAGGTGACGGCCGC and 5′- CGGCCAGGAAGCGGTTCA.

qRT-PCR was performed using the Light Cycler 480 II detection system and software (Applied Biosystems, Darmstadt, Germany) with KAPA SYBR FAST Light Cycler 480 Kit (PeqLab, Erlangen, Germany). Following primers were used: BCOR: 5′- GGCAGCTCTGTTTGTGAACC and 5′- CCTGAGCCACAGATACTTGG; GLI1: 5′- AGCTTG TCCCACACCGGTAC and 5′- GAGGATGCTCCAT TCTCTGGTG; AXIN2: 5′-GCTCAGAGCTTGACCCTGG and TCATACATCGGGAGCACCGT; LEF1: 5′-GAAGC CTCAGCATGAACAGAGAAA and 5′- ATAATATTTA GCCTGCTCTTCACGG; SMO: 5′-CCCTGTGGCA ACTCCAGTG and 5′-CAGCCACCAGGCATTTCTGC; HPRT1: 5′-TGACACTGGCAAAACAATGCA and 5′-GGTCCTTTTCACCAGCAAGCT. After normalization to the housekeeping gene HPRT1, the relative quantification value was expressed as 2^−ΔΔCt. The calibrator was calculated as the maximal number of cycles used in the PCR (40) minus the mean of the HPRT1 Ct values, resulting in a value of 19.