Pcdna3.3 topo vector

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PcDNA3.3-TOPO vector is a cloning vector used for the expression of recombinant proteins in mammalian cell lines. It contains essential elements for high-level expression, including a strong CMV promoter and a Kozak sequence for efficient translation initiation. The vector also includes a T7 promoter for in vitro transcription and a TOPO cloning site for efficient insertion of PCR products.

Automatically generated - may contain errors

Lab products found in correlation

Hygromycin b, by Merck Group (2 mentions) Fugene reagent, by Promega (2 mentions) Htert rpe1 cells, by American Type Culture Collection (2 mentions) Nanodrop, by Thermo Fisher Scientific (2 mentions) Phusion hot start high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions) Bigdye terminator cycle sequence ready reaction kit, by Thermo Fisher Scientific (1 mentions) Pgem t easy plasmid, by Promega (1 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions) Fugene 6 transfection reagent, by Promega (1 mentions) Nucleobond xtra midi plus kit, by Macherey-Nagel (1 mentions) Xfect transfection reagent, by Takara Bio (1 mentions) Akta prime plus, by GE Healthcare (1 mentions) Mcf 12a, by American Type Culture Collection (1 mentions) Plenti ef1a gfp 2a puro vector, by Applied Biological Materials (1 mentions) Lipofectamine ltx reagent, by Thermo Fisher Scientific (1 mentions) Universal mycoplasma detection kit, by American Type Culture Collection (1 mentions) Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions)

11 protocols using pcdna3.3 topo vector

Stable Cell Lines for Protein Trafficking

Check if the same lab product or an alternative is used in the 5 most similar protocols

The NIH/3T3 cell line stably expressing RHO^P23H was a generous gift from Yuanyuan Chen (Case Western Reserve University)^{19 (link)}. CNGB1 fused to a fluorescent protein Dendra2^{22 (link)} (Dend2-CNGB1) was cloned into the pcDNA3.3-TOPO vector (Life Technologies). hTERT-RPE1 cells (ATCC, Manassas, VA), grown in DMEM/F12 with 10% FBS, 0.01 mg/ml hygromycin B (Sigma-Aldrich), and 1% penicillin/streptomycin at 37 °C with 5% CO₂, were first transfected with pCDNA3.3 Dend2-CNGB1 using the FuGENE reagent (Promega) according to the manufacturer’s instructions. After 24 h post-transfection, cells were treated with G418 (500 μg/ml, Life Technologies). After 2 weeks of selection, the hTERT-RPE1 Dend-2-CNGB1 cell line was successfully obtained. Stable cells (NIH/3T3 cells expressing RHO^P23H or CLRN^N48K and hTERT-RPE1 cells expressing Dend2-CNGB1) were treated with either DMSO, bortezomib (50 nM), BF844 (2.9 μM) or BF981 (2.5 μM) for 24 h. Cells were then harvested and immunoblotting analyses were performed as described previously. 1D4 monoclonal antibody, rabbit Dendra2 antiserum^{45 (link)} and HA monoclonal antibody were used for immuno-detection of RHO^P23H, Dend2-CNGB1 and CLRN^N48K, respectively.

Alagramam K.N., Gopal S.R., Geng R., Chen D.H., Nemet I., Lee R., Tian G., Miyagi M., Malagu K.F., Lock C.J., Esmieu W.R., Owens A.P., Lindsay N.A., Ouwehand K., Albertus F., Fischer D.F., Bürli R.W., MacLeod A.M., Harte W.E., Palczewski K, & Imanishi Y. (2016). A small molecule mitigates hearing loss in a mouse model of Usher syndrome III. Nature chemical biology, 12(6), 444-451.

+ Open protocol

+ Expand

Recombinant RECK Isoform Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR amplification was carried out using the Phusion Hot Start High Fidelity DNA Polymerase (Finnzymes, Espoo, Finland), according to the manufacturer's recommendations. The sets of primers were designed using Primer3 and validated through BLAST and BLAT (Table S1). The PCR products were purified, sub-cloned into a pGEM-T Easy plasmid (Promega) and sequenced using the BigDye Terminator Cycle Sequence Ready Reaction Kit (Applied Biosystems). The RECK proteins coding sequences were amplified and cloned into the p156RRLsinPPCCMVIns3IRESPRC vector (a generous gift from Dr. Inder Verma, Salk Institute for Biological Studies, La Jolla, CA, USA). The coding sequences to each of the RECK isoforms were amplified using a primer containing the sequence to a C-terminal eight Histidine-Tag (His-Tag). These amplicons were then cloned into the pcDNA3.3-TOPO vector (Life Technologies), and, subsequently, the integrity of these constructs was assessed through DNA sequence analysis.

Trombetta-Lima M., Winnischofer S.M., Demasi M.A., Filho R.A., Carreira A.C., Wei B., de Assis Ribas T., Konig M.S., Bowman-Colin C., Oba-Shinjo S.M., Marie S.K., Stetler-Stevenson W, & Sogayar M.C. (2015). Isolation and characterization of novel RECK tumor suppressor gene splice variants. Oncotarget, 6(32), 33120-33133.

+ Open protocol

+ Expand

Stable Cell Lines for Protein Trafficking

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Knockdown and Overexpression of lincRNA-Cox2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two siRNAs targeted separate sequence of lincRNA-Cox2 were synthesized by Exiqon and used to knockdown lincRNA-Cox2 in cells: lincRNA-Cox2-siRNA-A (Sense sequence: GCCCUAAUAAGUGGGUUGUUU) and lincRNA-Cox2-siRNA-B (Sense sequence: AAGAGUAAGAUUCUGAAGAUCUU). LincRNA-Cox2-siRNA-A targets the 1008-1027 nt of lincRNA-Cox2 sequence (NR_110420.1). LincRNA-Cox2-siRNA-B targets the 558-580 nt of lincRNA-Cox2 as in the study by the Fitzgerald group (23 (link)). Sense sequence of siRNA for MyBBP1A is CCGGAGUGTAUUUGGUCAUAUCUUU and non-specific scrambled sequence UUCUCCGAACGUGUCACGUUU synthesized by Exiqon as for the control. The lincRNA-Cox2 expression vector was generated by RT-PCR amplification of lincRNA-Cox2 cDNA, using RNA from BV2 cells and cloned into the pcDNA3.3-TOPO vector (Life Technologies). Plasmids for luciferase reporter assay were generated by PCR amplification of DNA from BV2 cells using primers with built in Mlu I and Xho I restriction sites, allowing directional cloning into the pGL3-CMV reporter construct (Promega). The genomic coordinates of the luciferase reporter inserts are listed in Table S1.

Hu G., Gong A.Y., Wang Y., Ma S., Chen X., Chen J., Su C.J., Shibata A., Strauss-Soukup J.K., Drescher K.M, & Chen X.M. (2016). LincRNA-Cox2 Promotes Late Inflammatory Gene Transcription in Macrophages through Modulating SWI/SNF-mediated Chromatin Remodeling. Journal of immunology (Baltimore, Md. : 1950), 196(6), 2799-2808.

+ Open protocol

+ Expand

Targeted RNA Interference and Plasmid Cloning in Cryptosporidium

Check if the same lab product or an alternative is used in the 5 most similar protocols

Custom-designed RNA oligos against Cdg7_Flc_0990, HSP70, PRDM1, and a scrambled RNA were synthesized by Integrated DNA Technologies (Coralville, Iowa) and transfected into cells with Lipofectamine RNAimax according to the manufacturer’s protocol (Invitrogen). Sequences of siRNAs are: GCCCUAAUAAGUGGGUUGUUU for Cdg7_Flc_0990; CCGGAGUGTAUUUGGUCAUAUCUUU for PRDM1; GCCCUAAUAAGUGGGUUGUUU for HSP70; and non-specific scrambled sequence UUCUCCGAACGUGUCACGUUU for the control. The Cdg7_Flc_0990 expression vector was generated by RT-PCR amplification of Cdg7_Flc_0990 cDNA, using RNA from C. parvum sporozoites (Iowa strain) and cloned into the pcDNA3.3-TOPO vector according to the manufacturer’s protocol (Life Technologies). The sequences for plasmid generation are listed in supplemental Table S1.

Wang Y., Gong A.Y., Ma S., Chen X., Strauss-Soukup J.K, & Chen X.M. (2017). Delivery of Parasite Cdg7_Flc_0990 RNA Transcript into Intestinal Epithelial Cells during Cryptosporidium parvum Infection Suppresses Host Cell Gene Transcription through Epigenetic Mechanisms. Cellular microbiology, 19(11), 10.1111/cmi.12760.

+ Open protocol

+ Expand

Generating Pseudovirus with Immune Escape Mutations

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CH0848 T/F envelope (env) sequence was chemically synthesized (GenScript, USA) and cloned into the pcDNA3.3-TOPO vector (Invitrogen, USA). Immune escape mutations were introduced into the CH0848 T/F env by site-directed mutagenesis. All env clones were confirmed by sequencing. Pseudovirus stock was prepared as previously described (Song et al., 2016 (link)). In brief, 2 μg of each env clone was co-transfected with 4 μg of pNL4.3-ΔEnv-vpr + -luc + into 293 T cells in a T25 flask using the FuGENE6 transfection reagent (Promega, USA). The culture supernatants containing the pseudoviruses were harvested at 72 h post transfection, aliquoted and stored at −80 °C until use. The infectious titers (TCID₅₀) of the virus stocks were determined on TZM-bl cells.

Marichannegowda M.H, & Song H. (2022). Immune escape mutations selected by neutralizing antibodies in natural HIV-1 infection can alter coreceptor usage repertoire of the transmitted/founder virus. Virology, 568, 72-76.

+ Open protocol

+ Expand

Cloning and Characterization of Human XIST

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human XIST clone (NR_001564.2, bp 61–5349) was purchased from
Origene (SC312039). We designed two constructs using the secondary structure of
Xist [21 (link)] as a guide to ensure secondary
structural elements are not disrupted. Fragment 1 (F1) contains both repeat A
and repeat F regions (1–1747, Forward primer: CACCCTGGAAGCTTCCTGACTGAAG,
Reverse primer: TACCGCCCACTGGGAGAC) and Fragment 2 (F2) contains, repeat B and
repeat C regions (1748–5275, Forward primer: CACCACACCAGGTGTTTTCAAGGTCT,
Reverse Primer: AATGTTGGCCAGGCTGGT). These fragments were cloned into pcDNA
3.3-TOPO vector (Invitrogen).

Shenoda B.B., Ramanathan S., Gupta R., Tian Y., Jean-Toussaint R., Alexander G.M., Addya S., Somarowthu S., Sacan A, & Ajit S.K. (2020). Xist attenuates acute inflammatory response by female cells. Cellular and molecular life sciences : CMLS, 78(1), 299-316.

+ Open protocol

+ Expand

Construction of V5-Tagged and SUMOylation Mutant HuR Plasmids

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full length cDNA of WT mouse HuR was purchased from the German Resource Center for Genome Research (RZPD). The V5-HuR WT plasmid was constructed by PCR using a 5′ oligonucleotide containing the V5 tag sequence and being subcloned into a pcDNA3.3-TOPO vector (K830001, Invitrogen).^{66 (link)} SUMOylation sites on HuR were predicted experimentally by mutation of lysine residues into arginine. The SUMOylation mutant HuR plasmid constructs were created using the QuickChange site-directed mutagenesis kit (200518, Stratagene), according to the manufacturer’s instructions, with two complementary oligonucleotides and with pcDNA3.3-TOPO-V5-HuR WT plasmid as template. Products were sequenced by STAB vida. Plasmid DNA was purified after bacterial transformation and amplification, using NucleoBond Xtra Midi Plus kit (740412, Macherey-Nagel), by following the manufacturer’s instructions.

Lachiondo-Ortega S., Rejano-Gordillo C.M., Simon J., Lopitz-Otsoa F., Delgado T.C., Mazan-Mamczarz K., Goikoetxea-Usandizaga N., Estefanía Zapata-Pavas L., Garcıía-del Río A., Guerra P., Peña-Sanfélix P., Hermán-Sánchez N., Al-Abdulla R., Fernandez-Rodríguez C., Azkargorta M., Velázquez-Cruz A., Guyon J., Martín C., Zalamea J.D., Egia-Mendikute L., Sanz-Parra A., Serrano-Maciá M., González-Recio I., Gonzalez-Lopez M., Martínez-Cruz L.A., Pontisso P., Aransay A.M., Barrio R., Sutherland J.D., Abrescia N.G., Elortza F., Lujambio A., Banales J.M., Luque R.M., Gahete M.D., Palazón A., Avila M.A., Marin J.J., De S., Daubon T., Díaz-Quintana A., Díaz-Moreno I., Gorospe M., Rodríguez M.S, & Martínez-Chantar M.L. (2024). SUMOylation controls Hu antigen R posttranscriptional activity in liver cancer. Cell reports, 43(3), 113924.

+ Open protocol

+ Expand

Generating EML4-ALK Variant Expressing Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The coding sequence for EML4-ALK variant 3a (v3a) or variant 3b (v3b) was amplified from the total complementary DNA (cDNA) of the H2228 cells. The cDNA for EML4-ALK v3a or v3b was cloned into the pcDNA 3.3-TOPO vector (Invitrogen). The empty pcDNA 3.3-TOPO vector, pcDNA 3.3-TOPO-EML4-ALK v3a, and pcDNA 3.3-TOPO-EML4-ALK v3b were transfected into the PC-9 cells by using the Xfect transfection reagent (Clontech Laboratories, Mountain View, CA), and the cells were considered transiently expressing cells. To establish cells stably expressing transfected genes, the cells were further incubated in 500 mg/mL G418 (Geneticin, Gibco, Grand Island, NY), and the selected cells were considered stably expressing cells. To obtain EML4-ALK v3a or v3b functional cells, PC-9 cells with a stable expression of EML4-ALK v3a or v3b were incubated with 1 μM gefitinib for 1 week, and the selected cells were expanded and used in further studies.

Huang M.H., Lee J.H., Hung P.S, & Chih-Hsin Yang J. (2022). Potential Therapeutic Strategy for EGFR-Mutant Lung Cancer With Concomitant EML4-ALK Rearrangement—Combination of EGFR Tyrosine Kinase Inhibitors and ALK Inhibitors. JTO Clinical and Research Reports, 3(11), 100405.

+ Open protocol

+ Expand

Recombinant SARS-CoV-2 Protein Production

Check if the same lab product or an alternative is used in the 5 most similar protocols

S1 protein and RBD protein recombinant plasmids were prepared using the pcDNA™3.3-TOPO^® vector (ThermoFisher, Waltham, MA. United States. Cat No. K8300-01). The vector was injected into the Chinese Hamster Ovary (CHO) cell to express the protein. After culturing the transformed CHO cells, the supernatant is collected, filtered, and purified by column loading (GE healthcare, AKTA prime plus). After purification, the protein is identified by SDS-PAGE and Western Blotting. The purified antigen is used as the vaccine antigen after checking the concentration using Nanodrop (ThermoFisher, Waltham, MA. United States. AZY2017596) (Figure 1).

Ga E., Won Y., Hwang J., Moon S., Yeom M., Lyoo K., Song D., Han J, & Na W. (2022). A COVID-19 Vaccine for Dogs Prevents Reverse Zoonosis. Vaccines, 10(5), 676.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!