Various DNA constructs were prepared by the subcloning of either the open reading frame (ORF) or knockdown oligomers in the corresponding expression plasmid vectors in (Table 1 ). The expression vector was produced by subcloning of the ORF of mouse Rbms1 (NCBI accession No. NM_001141931) into the base vector pCAGIG (Connie Cepko [plasmid #11159]; Addgene, USA) and that for the knockdown vector by inserting 19-mer shRNA oligonucleotide of 5’ GGAGACGTCTAATGACCATTC 3’ into pGPH1/GFP/Neo vector (Bicistronic GFP shRNA vector; GenePharma, China). FLAG-tagged Rbms1 expression vector were prepared by subcloning of Rbms1 ORF into the N-terminal FLAG vector, pCMV3-N-FLAG. The mouse Rbms1 addback vector was generated by mutating four nucleotides of shRbms1 targeting sequence in complete ORF of mouse Rbms1; the sequence changes were as 5’ G/AGAG/AACGTCT/GAATGACCAT/CTC 3’, without changing their coding amino acids. The mutant subcloned into pCAGIG by Enzynomics (Korea).
Pgph1 gfp neo vector
Manufactured by GenePharma
Sourced in China
The PGPH1/GFP/Neo vector is a plasmid-based expression system designed for gene expression studies. It contains the GFP (Green Fluorescent Protein) gene, which allows for the visualization of transfected cells, and the Neomycin resistance gene, which enables selection of cells expressing the vector. The vector is driven by the PGK1 (Phosphoglycerate Kinase 1) promoter.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using pgph1 gfp neo vector
1
Construct Generation and Validation of Rbms1
2
Lentiviral Transduction of TSPAN5 and Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviruses, packaged with the Ubi‐MCS‐3FLAG‐CBh‐gcGFP‐IRES‐puromycin vector containing a full coding region of the TSPAN5 gene (NM_005723), were purchased from Shanghai GeneChem Co., Ltd (Zhangjiang Hi‐Tech Park, Shanghai, China). The lentiviruses, packaged with the pGPH1/GFP/Neo vector containing short hairpin RNA (shRNA) sequence targeting Tspan5 (sh1009:5′‐GCAGAAGATGTCATCAACACT‐3′) or scrambled control sequence (5′‐GTTCTCCGAACGTGTCACGT‐3′), were purchased from Shanghai GenePharma Co., Ltd (Zhangjiang Hi‐Tech Park). The viruses were transduced into HCC cell lines according to the manufacturer protocol. Puromycin (3–5 μg·mL−1) was used for selection of stable cell lines. The lentiviruses used for in vivo imaging experiments were packaged with the pLenti‐CBh‐3FLAG‐luc2‐tCMV‐tdTomato‐F2A‐blasticidin vector and purchased from Shanghai Obio Technology Co., Ltd (Pudong New Area, Shanghai, China). Blasticidin (10 μg·mL−1) was used for selection of stable cells. All functional experiments were conducted within 2 weeks following the lentiviral infection.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!