Gel doctm ez gel documentation system

For protein analyses cells were subjected to 12% (w/v) sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE) as described by Laemmli (1970) (link). To visualize and confirm protein separation, 2,2,2-trichloroethanol was incorporated into the polyacrylamide gels (Ladner et al., 2004 (link)) and detected within a Gel Doc^TM EZ gel documentation system (Bio-Rad). Afterward the proteins were transferred onto nitrocellulose membranes (Whatman) which were then subjected to immunoblotting. In a first step the membranes were incubated either with 0.1 μg/mL Anti-6×His^® antibody (Abcam, Inc.) to detect EF-P, or with 0.25 μg/ml Anti-Arg^Rha antibody (Li et al., 2016 (link); Krafczyk et al., 2017 (link)) to visualize rhamnosylation. These primary antibodies (rabbit) were then targeted with 0.2 μg/ml Anti-rabbit alkaline phosphatase-conjugated secondary antibody (Rockland). Localization was visualized by adding development solution [50 mM sodium carbonate buffer, pH 9.5, 0.01% (w/v) p-nitro blue tetrazolium chloride (NBT) and 0.045% (w/v) 5-bromo-4-chloro-3-indolyl-phosphate (BCIP)].

PCR was performed using 1 × MyTaq Red Mix (Bioline), 0.2 μM of each forward (ITS1 TCCGTAGGTGAACCTGCGG) and reverse (ITS4 TCCTCCGCTTATTGATATGC) primers, and 1 μL of gDNA as template. Thermocycling conditions were optimized at 94°C for 2 min, followed by 40 cycles of 94°C for 15 s, 60°C for 30 s and 72°C for 30 s, with a final extension step of 72°C for 2 min. PCR products were run on 2% (w/v) agarose, 1 × TBE gels with 1 μL SYBR^® Safe DNA Gel Stain (Invitrogen, Paisley, United Kingdom) at 100 V for 30 min and analyzed in a Gel Doc^TM EZ Gel Documentation System (Bio-Rad, Oxford, United Kingdom). Products were submitted for sequence analysis to Macrogen⁵ to verify the authenticity of the starting material.