Sw480

CRC cell lines (LoVo, SW620, HCT116 and SW480) and normal cells HIEC were obtained from Cobioer (Nanjing, China) and followed their instructions to culture at 37°C. Sh-LncRNA DLEU1(sequence: CAACGGAAUGUAUCAAUGATT), sh-PRPS1(sequence: GCAGCTCCCACCAGGACTTAT), sh-NC(sequence: TTCTCCGAACGTGTCACGT), miR-320b mimics(sequence: AAAAGCUGGGUUGAGAGGGCAA), NC mimics(sequence: UUCUCCGAACGUGUCACGUTT), miR-320b inhibitors(sequence: UUGCCCUCUCAACCCAGCUUUU) and NC inhibitors(sequence: CAGUACUUUUGUGUAGUACAA) were obtained from RIBOBIO (Guangzhou, China). Cell transfection was conducted following the instruction of Lipofectamine 2000 (Invitrogen, CA, USA). Stably DLEU1-knockdown cell lines were screened out as previously reported (20 (link)). In brief, oligonucleotide for small hairpin RNA (shRNA) targeting DLEU1 was synthesized and inserted into the shRNA vector pGPH1/Neo (GenePharma, Shanghai, China). The DLEU1 shRNA vector was transfected into LoVo and SW480 cells with Lipofectamine 3000 (Invitrogen, CA, USA) and selected for 4 weeks with neomycin (1000 μg/ml). Scrambled shRNA (sh-NC) was applied as control. After culturing for 48 h, cells were utilized for follow-up study.

Cell lines including A549, H460, A375, A2058, A673, Saos2, U87, SW‐13, Hela, SW1990, MDA‐MB‐231, SW480, LNCaP, PC‐3, MRC5, and HEK293 were purchased from Cobioer Biosciences Co., Ltd. (Nanjing City, China) Cell lines (A549, H460, A375, A2058, A673, Saos2, U87, SW‐13, Hela, SW1990, MDA‐MB‐231, SW480, LNCaP, PC‐3, MRC5, and HEK293) were cultured in DMEM (Hyclone, South Logan, UT, USA), supplemented with 5% fetal bovine serum (FBS) (Gibco, South Logan, UT, USA), 2 mm GlutaMAX, and 0.1 mm non‐essential amino acids. hESC (Wicell, Madison, USA) cells were cultured in mTeSR™1 (Stem Cell Technologies). All cell cultures were maintained at 37 °C under 5% CO2. Transfection with Lipofectamine 2000 (Invitrogen, Carlsbad, California, USA) was performed according to the manufacturer's instructions. For stable transfection, the cells were cultured in the presence of 100 μg·mL⁻¹ hygromycin B (Invitrogen). The resistant colonies were pooled and expanded for further analysis.