Sybr gold

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, Japan, China, Canada, Spain

SYBR Gold is a nucleic acid stain used for the detection and quantification of DNA and RNA in gel electrophoresis and other applications. It is a sensitive, fluorescent dye that binds to nucleic acids, allowing the visualization and analysis of DNA and RNA samples.

Automatically generated - may contain errors

Lab products found in correlation

Comet assay kit, by Bio-Techne (24 mentions) Chemidoc mp imaging system, by Bio-Rad (15 mentions) Cometslide, by Bio-Techne (15 mentions) Gel loading buffer 2, by Thermo Fisher Scientific (14 mentions) Chemidoc xrs system, by Bio-Rad (14 mentions) Nanodrop 2000, by Thermo Fisher Scientific (14 mentions) Trizol, by Thermo Fisher Scientific (13 mentions) Typhoon fla 9500, by GE Healthcare (12 mentions) Nanodrop, by Thermo Fisher Scientific (12 mentions) Tbe urea gel, by Thermo Fisher Scientific (10 mentions) Typhoon 9210 imager, by GE Healthcare (9 mentions) Gel doc ez imager, by Bio-Rad (9 mentions) Trizol reagent, by Thermo Fisher Scientific (9 mentions) Proteinase k, by New England Biolabs (8 mentions) Gel doc xr system, by Bio-Rad (8 mentions) Quantity one software, by Bio-Rad (8 mentions) Image lab software, by Bio-Rad (8 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (8 mentions) Dp72 microscope camera, by Olympus (7 mentions) Bx40 microscope, by Olympus (7 mentions)

1 011 protocols using sybr gold

Folding and Analysis of tRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Prior to enzyme addition tRNA was folded by heating for 4 min at 75°C in water and cooling to room temperature in 15 min after addition of MST buffer to 1x MST buffer final. All reactions were incubated for the times indicated, following 5 min incubation in 0.5× the respective loading dye at either 25°C or 95°C. All gels, either 20 × 30 cm 10% 8 M urea PAGE or 20 × 10 cm 10% SDS-PAGE with 6% stacking gel, were run at 100 V and room temperature. Gels were first scanned with a GE Healthcare Typhoon 9400 for Cy5 (excitation 633 nm, emission 670BP30) and then stained with SYBR Gold (Invitrogen), scanned for SYBR Gold (excitation 488 nm, emission 520BP40) and, if indicated, FRET (Förster resonance energy transfer) from SYBR Gold to Cy5 (excitation 488 nm, emission 670BP30), followed by Coomassie G-250 staining.

Spenkuch F., Hinze G., Kellner S., Kreutz C., Micura R., Basché T, & Helm M. (2014). Dye label interference with RNA modification reveals 5-fluorouridine as non-covalent inhibitor. Nucleic Acids Research, 42(20), 12735-12745.

+ Open protocol

+ Expand

Frozen Section Staining Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Frozen sections were fixed in 4% paraformaldehyde in PBS and stained
with either hematoxylin and eosin or SYBR Gold and DAPI as described
previously.^{45 (link)} Briefly, slides were stained
in a solution of SYBR Gold (Life Technologies, Grand Island, NY),
phenol, glycerin, and isopropanol in distilled water with gentle heating,
washed with acid alcohol (0.5% hydrochloric acid, 70% isopropanol)
for 3 min, then washed in water, and mounted using Prolong Gold antifade
(Life Technologies) mounting medium. Slides were visualized using
a Nikon Intensilight mercury vapor lamp and scanned using a Nikon
TE-I motorized microscope controlled by Nikon NIS Elements AR software
v. 4.00.01 (Nikon, Melville, NY) with FITC, TRITC, and DAPI filters.

Irwin S.M., Prideaux B., Lyon E.R., Zimmerman M.D., Brooks E.J., Schrupp C.A., Chen C., Reichlen M.J., Asay B.C., Voskuil M.I., Nuermberger E.L., Andries K., Lyons M.A., Dartois V, & Lenaerts A.J. (2016). Bedaquiline and Pyrazinamide Treatment Responses Are Affected by Pulmonary Lesion Heterogeneity in Mycobacterium tuberculosis Infected C3HeB/FeJ Mice. ACS Infectious Diseases, 2(4), 251-267.

+ Open protocol

+ Expand

Fluorescent Titration Shift Assay Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

FTS experiments were based on the method described by Müller et al^{16 (link)}. Gels were prepared with 50 mM Tris-acetate (pH 7.5), 10 mM MgAc₂, and 10% (19:1) acrylamide/bis-acrylamide, then polymerized as described above. RNAs and tet/dox were combined and diluted to assay concentrations in binding buffer (20 mM Tris-HCl (pH 7.5), 100 mM NaCl, 10 mM MgCl₂), denatured at 65°C for 5 min, and cooled at room temperature for 45 minutes. Following incubations, 16.7% gycerol was added and vortexed to weight samples for gel loading. Gels were pre-run for 30 min at 1W, loaded, and samples separated for 6h at 1W. Following electrophoresis, gels were transferred to a ChemiDoc XRS gel imaging system (Bio-Rad #1708265). Tet/dox fluorescence was imaged using UV excitation and a 530/28 nm filter. Gels were then stained for 5 min using 0.2X SYBR-Gold (Thermo #S11494), washed, destained for 10 min, and imaged using SYBR-Gold filter settings. Composite gel images were generated using ImageJ.

Tickner Z.J., Zhong G., Sheptack K.R, & Farzan M. (2020). Selection of high affinity RNA aptamers that distinguish between doxycycline and tetracycline. Biochemistry, 59(37), 3473-3486.

+ Open protocol

+ Expand

Characterization of RNA Oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA oligonucleotides were synthesized by Integrated DNA Technologies (IDT). To equilibrate, RNAs were diluted to 10 μM in indicated salt solution, heated to 95 °C for 10 min and allowed to cool to room temperature overnight. For analysis on acrylamide gels, 10 pmol or 50 pmol were ran through a gel and stained with SYBR gold or NMM, respectively. For SYBR gold staining, gels were post-stained in a solution of 1X SYBR gold (ThermoFisher Scientific) in 0.5X TBE for 10 min. For NMM staining, gels were post-stained in a solution 0.1 mg ml⁻¹ of NMM in 0.5X TBE for 10 min. Following staining, gels, were destained for 20 min in 0.5X TBE while rocking at room temperature. Gels were visualized using a 265 nm UV transilluminator.

Lyons S.M., Gudanis D., Coyne S.M., Gdaniec Z, & Ivanov P. (2017). Identification of functional tetramolecular RNA G-quadruplexes derived from transfer RNAs. Nature Communications, 8, 1127.

+ Open protocol

+ Expand

DNA Gel Electrophoresis with Denaturing Buffers

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each DNA sample, the concentration was pre-adjusted to 10 ng/μL. For non-denatured native gels, 4 μL (40 ng) of DNA was taken out and mixed with 1.5 μL of 6× purple gel loading dye, no SDS (NEB). The mixed DNA samples were immediately loaded onto 1% agarose TBE gels, and the gel was run for 1.5 hours at 90 V. The gel was post stained with SybrGold (Thermo Fisher) for 2 hours. For denaturing gels, 5 μL (50 ng) of DNA was taken out each time and separately mixed with 15 μL of 0.2% denaturing buffer (0.27% sodium hydroxide, 10% glycerol, 0.013% bromophenol blue), 0.4% denaturing buffer (0.53% sodium hydroxide, 10% glycerol, 0.013% bromophenol blue), or 1% denaturing buffer (1.33% sodium hydroxide, 10% glycerol, 0.013% bromophenol blue) at 0°C. The mixed DNA samples were denatured at 4°C for 10 min and immediately loaded onto 1% agarose TBE gels. The gel was run for 1.5 hours at 90 V. The gel was post stained with SybrGold (Thermo Fisher) for 2 hours.

Xue M., Kim C., Healy A., Wernke K., Wang Z., Frischling M., Shine E., Wang W., Herzon S, & Crawford J. (2019). Structure elucidation of colibactin and its DNA cross-links. Science (New York, N.Y.), 365(6457), eaax2685.

+ Open protocol

+ Expand

Characterization of RNA Oligonucleotide Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA oligonucleotides were purchased from Integrated DNA Technologies (IDT). To equilibrate, RNAs were diluted to 10 μM in the indicated salt solution, heated to 95 °C for 5 min, and slowly allowed to cool to room temperature. For analysis on acrylamide gels, 10 pmol or 50 pmol were run through a gel and stained with SYBR gold or NMM derivatives, respectively. For SYBR gold staining, gels were post-stained in a solution of 1X SYBR gold (ThermoFisher Scientific) in 0.5X TBE for 10 min. For NMM staining, gels were post-stained in 100 µM solution of NMM in 0.5X TBE for 30 min. Following staining, gels were destained for 20 min in 0.5X TBE while rocking at room temperature. Gels were visualized using a 265 nm UV transilluminator.

Kharel P., Fay M., Manasova E.V., Anderson P.J., Kurkin A.V., Guo J.U, & Ivanov P. (2023). Stress promotes RNA G-quadruplex folding in human cells. Nature Communications, 14, 205.

+ Open protocol

+ Expand

Gel Electrophoresis of Nucleic Acid Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Complexes were prepared at different N/P ratios after which an aliquot corresponding to 6 pmol of ON was diluted in H2O and 6x Loading buffer, and loaded in 4-20% (w/v) polyacrylamide-TBE gels (Novex TBE Gels, Invitrogen). Gels were stained postrun with SYBRGold (Molecular Probes, Invitrogen) in 1x TBE solution. Gels were visualized in a GelDoc XR imaging system (BioRad) and analyzed using IMAGELAB software (BioRad).
For analysis of heparin-induced dissociation of complexes, these were prepared at N/P ratio 80 after which an aliquot was diluted in 1x phosphate buffer saline containing different Heparin concentrations (previously diluted in 1x PBS also). Complexes and heparin were then incubated for 2 h at 37 °C. After incubation complexes (corresponding to 6 pmol ON) were loaded in 4-20% polyacrylamide-TBE gels and stained postrun with SYBRGold (Molecular Probes, Invitrogen).

Moreno P.M., Santos J.C., Gomes C.P., Varela-Moreira A., Costa A., Leiro V., Mansur H, & Pêgo A.P. (2016). Delivery of Splice Switching Oligonucleotides by Amphiphilic Chitosan-Based Nanoparticles. Molecular pharmaceutics, 13(2).

+ Open protocol

+ Expand

Optimizing Agarose Gel Electrophoresis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Various percentages of agarose gel solutions were prepared with agarose LE powder (Gold Biotechnology) using 0.5× TB buffer (45 mM Tris, 45 mM boric acid) [28 (link)]. To ensure uniform depth of the viscous high-percentage gels, a taped 11×14 cm gel tray was pre-incubated at 60°C while the gel solution was prepared (~ 3 minutes). The gel was then poured into the pre-warmed tray in the incubator; a 10- or 12-well comb was inserted and the gel solution was allowed to settle for two minutes. The tray was then removed from the incubator and allowed to solidify at room temperature for at least 20 minutes. All gels contained 45, 50, or 55 mL total volumes and the solidified gels were approximately 6 – 8 mm thick. Gels were run in a submarine-style electrophoresis rig (Horizon 11–14 from Labrepco) in 0.5× TB buffer at the indicated voltages and times. Most electrophoreseis experiments were performed using a GE Healthcare EPS601 power supply. After electrophoresis, gels were stained for 40 minutes with mild shaking in 50 mL 2× SYBR Gold (Invitrogen), which was created by diluting 10 μL SYBR Gold stock into 50 mL 0.5× TB buffer (1:5000 dilution). To reduce background signal, the agarose gel was destained in ~150 mL 0.5× TB for 15 minutes with shaking.

Ream J.A., Lewis L.K, & Lewis K.A. (2016). Rapid agarose gel electrophoretic mobility shift assay for quantitating protein:RNA interactions. Analytical biochemistry, 511, 36-41.

+ Open protocol

+ Expand

Quantifying Total Cell Numbers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cell numbers were quantified via SYBR‐Gold (Invitrogen; CA, USA) staining. From each sampling site 4.75 ml of water was fixed with 0.25 ml 37% formaldehyde. One ml of an appropriate dilution of the fixed water sample (1:10 for samples from Neusiedler See; 1:100 for samples from the shallow alkaline lakes) was filtered on Anodisc filters (Ø 25 mm, pore‐size 0.2 μm, Whatman) and stained on a drop of SYBR‐Gold (Invitrogen, Lofer, Austria; 1:400× dilution of the stock) for 20 min. After drying, the filters were mounted on a microscopic slide under a drop of anti‐fading solution and analysed in a Nikon Eclipse 8000 microscope. Detailed information on the enumeration procedure can be found elsewhere (Riepl et al., 2011).

Schauer S., Jakwerth S., Bliem R., Baudart J., Lebaron P., Huhulescu S., Kundi M., Herzig A., Farnleitner A.H., Sommer R, & Kirschner A. (2015). Dynamics of V ibrio cholerae abundance in Austrian saline lakes, assessed with quantitative solid‐phase cytometry. Environmental Microbiology, 17(11), 4366-4378.

+ Open protocol

+ Expand

EMSA Assay for Protein-DNA and Protein-Nucleosome Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

For EMSA with short oligonucleotide DNA, 25 bp double-stranded DNA (50 nΜ) containing the Nr5a2 consensus motif (GAGAGAGTCAAGGCCATGGCTCACT) was incubated with NR5A2 at room temperature for 30 min in a reaction buffer (20 mM Tris-HCl (pH7.5), 120 mM NaCl, 1 mM MgCl₂, 10 μΜ ZnCl₂, 1 mM DTT, 100 μg ml^–1 BSA). After the incubation, the samples were loaded onto 10% non-denaturing polyacrylamide gels (0.5×TBE), and electrophoresis was performed at 100 V for 1 h at room temperature. The gels were stained by SYBR Gold (Invitrogen) and were imaged using GelDoc Go imaging system (Bio-Rad).
For EMSA with nucleosomes, nucleosomes (50 nΜ) were incubated with NR5A2 at room temperature for 30 min in a reaction buffer (20 mM Tris-HCl (pH7.5), 120 mM NaCl, 1 mM MgCl₂, 10 μΜ ZnCl₂, 1 mM DTT, 100 μg ml^–1 BSA). After the incubation, the samples were loaded onto 10% non-denaturing polyacrylamide gels (0.5×TBE), and electrophoresis was performed at 100 V for 70 min at room temperature. The gels were imaged by detecting Alexa Fluor 647 fluorescence and SYBR Gold (Invitrogen) using the ChemiDoc MP imaging system or the GelDoc Go imaging system (Bio-Rad).
For quantification, data from at least three replicates were analyzed using ImageLab (Bio-Rad) and plotted in Prism (GraphPad). Data are shown as mean and s.d.

Kobayashi W., Sappler A.H., Bollschweiler D., Kümmecke M., Basquin J., Arslantas E.N., Ruangroengkulrith S., Hornberger R., Duderstadt K, & Tachibana K. (2024). Nucleosome-bound NR5A2 structure reveals pioneer factor mechanism by DNA minor groove anchor competition. Nature Structural & Molecular Biology, 31(5), 757-766.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!