Cfx96 touch real time pcr detection system

Manufactured by Bio-Rad

Sourced in United States, China, Japan, Germany, Italy, United Kingdom, Canada, Switzerland, Poland, France, Singapore, Australia, Belgium, Norway, Netherlands, Spain, Finland, Czechia

The CFX96 Touch Real-Time PCR Detection System is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It is capable of detecting and quantifying targeted DNA or RNA sequences in a sample. The system uses a thermal cycler and optical detection modules to perform the necessary steps for real-time PCR experiments.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

CFX96 system (1167 citations) CFX96 Touch (391 citations) CFX96 detection system (252 citations) CFX96 PCR system (186 citations) CFX96 Touch System (185 citations) CFX96 Real-Time PCR (107 citations) CFX96 Touch Real-Time PCR (105 citations) Real-Time System (61 citations) Real-time CFX96 Touch (8 citations) PCR CFX96 (2 citations)

3 571 protocols using cfx96 touch real time pcr detection system

Quantification of miRNA Expression in Keratinocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from keratinocytes using TRIzol TM reagent (Invitrogen). cDNA was synthesized using RevertAid First Strand cDNA Synthesis kit (ThermoFisher). The quantitative PCR was carried out with SYBR Green qPCR Master Mix kit (TaKaRa) in CFX96 Touch TM Real-Time PCR Detection System (Bio-Rad). The quantitative PCR reaction procedure was 95 for 5 minutes, followed by 40 cycles at 95 for 5 seconds, 60 for 10 seconds, 72 for 10 seconds. GAPDH was used as an internal reference. Primers sequences were as follows:
MIR181A2HG, 5'-GTCGTTGCTGCTTTCTCCCA-3' (forward) and The expression of mature miRNAs was analyzed with Bulge-Loop TM miRNA qRT-PCR Starter Kit (RiboBio, Guangzhou, China). Total RNA was isolated from HaCaT keratinocytes using TRIzol TM reagent (Invitrogen) and reversely transcribed to cDNA with Bulge-Loop TM miRNA RT primers (RiboBio). The quantitative PCR was carried out in CFX96 Touch TM Real-Time PCR Detection System (Bio-Rad) with miR-181a, miR-181b and U6 Bulge-Loop TM primer (RiboBio). The reaction procedure was 95 for 10 minutes, followed by 40 cycles at 95 for 2 seconds, 60 for 20 seconds, 70 for 10 seconds. U6 served as an internal reference.
The relative expression was calculated by 2 -ΔΔCt .

Fan X., Yue P., Li M., Chen F., Fang J., Deng X., Liu X., Wei Z., Gan S., Weng C., & Gao J. (2022). LncRNA MIR181A2HG Negatively Regulates Human Keratinocytes Proliferation by Binding SRSF1.

+ Open protocol

+ Expand

RT-qPCR Analysis of miRNAs and mRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Using total RNA from above, complementary DNA (cDNA) was synthesized using the TaqMan miRNA Reverse Transcription kit (Applied Biosystems; #4366596) according to the manufacturer's instructions, or using the High-capacity RNA-to-cDNA kit (Applied Biosystems; #4387406). Real-time PCR amplification of miRNAs was performed using TaqMan miRNA assays in TaqMan Universal PCR Master Mix (Applied Biosystems; #4304437) on a Bio-Rad CFX96 Touch Real Time PCR Detection system (Bio-Rad Laboratories, Inc.). Reactions were performed in triplicate using RNU66 as the internal control. Real-time PCR amplification of mRNAs was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Inc.; #1725271) on a Bio-Rad CFX96 Touch Real Time PCR Detection system (Bio-Rad Laboratories, Inc.). Reactions were performed in triplicate using RPS9 as the internal control. All TaqMan assays used in this study were purchased from Applied Biosystems, Inc. and include miR-503 and RNU66.

Baran-Gale J., Purvis J.E, & Sethupathy P. (2016). An integrative transcriptomics approach identifies miR-503 as a candidate master regulator of the estrogen response in MCF-7 breast cancer cells. RNA, 22(10), 1592-1603.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

First, total RNA of each sample was extracted using AurumTM Total RNA Fatty and Fibrous Tissue Kit (Bio-Rad, USA) and was quantified by NanoDrop 1000 Spectrophotometer (Thermo Scientific, USA). Reverse transcription was then demonstrated via iSciptTM cDNA Synthesis Kit (Bio-Rad, USA) by adding 1 μg of total RNA on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, USA). Real-time PCR was performed by means of SsoFast™ EvaGreen® Supermixes (Bio-Rad, USA) on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, USA) through adding an equal volume (2 μl) of cDNA products of each sample. The target genes were Slc2a4 (for Glut4; Bio-Rad, qRnoCID0001996, USA) and Acss2 (for AceCS1; Bio-Rad, qRnoCID0005949, USA), β-actin was selected as an internal control (forward primer sequence: 5′-CGGTCAGGTCATCACTATC-3′; reverse primer sequence: 5′-TGCCACAGGATTCCATAC-3′). Further ΔCq of the target gene expression was calculated and normalized with β-actin by the equation ΔCq= Cq(target) – Cq(β-actin).

Chung Y.H., Lu K.Y., Chiu S.C., Lo C.J., Hung L.M., Huang J.P., Cheng M.L., Wang C.H., Tsai C.K., Lin Y.C., Chang S.H, & Lin G. (2018). Early Imaging Biomarker of Myocardial Glucose Adaptations in High-Fat-Diet-Induced Insulin Resistance Model by Using 18F-FDG PET and [U-13C]glucose Nuclear Magnetic Resonance Tracer. Contrast Media & Molecular Imaging, 2018, 8751267.

+ Open protocol

+ Expand

Optimization of Primer Concentrations for Multiplex PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The optimization of the primer quantity in the master mix was performed by mixing primers together at several quantities between 1 and 30 pmol. We started with equal concentrations of horse and porcine primers. The ratio of primer concentrations was adjusted afterwards, so that both amplicons were produced with high efficiency in the same reaction.
The PCR amplifications were performed in a final volume of 20 μL containing 4 μL of EvaGreen qPCR Mix (Solis Bio Dyne, Estonia), 10 pmol of horse primers, 14 pmol of porcine primers, and 200 ng of DNA template using a CFX96 Touch™ real-time PCR Detection System (BioRad, Hercules, USA). After an initial heat denaturation step at 94℃ for 10 min, 35 cycles were programmed as follows: 94℃ for 15 s, 58℃ for 20 s, and 72℃ for 20 s. All of the PCR reactions were applied in duplicate in two independent experiments.
At the end of each PCR, melting curve analysis tools of the CFX96 Touch™ real-time PCR Detection System (BioRad, Hercules, USA) were used to identify species specific Mp values of the amplified region of the template DNA that belong to reference meat samples. A melting curve analysis was programmed for its ramp formed from 72 to 95℃ by raising 1℃ in each step. The process paused for 90 s to perform a pre-melt conditioning on the first step and for 5 s for each step afterwards.

Sakalar E., Ergün S.Ö, & Akar E. (2015). A Simultaneous Analytical Method for Duplex Identification of Porcine and Horse in the Meat Products by EvaGreen based Real-time PCR. Korean Journal for Food Science of Animal Resources, 35(3), 382-388.

+ Open protocol

+ Expand

Quantifying mRNA and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated using the RNAiso Reagent extraction kit (Takara, Japan). For mRNA detection, a total of 400 ng RNA was subjected to reverse transcription-PCR reaction using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). qRT-PCR was performed in triplication using SYBR Green PCR Master Mix (BioRad, USA) and CFX96 Touch™ Real-Time PCR Detection System (BioRad, USA) with the following cycle parameters: 95°C 3 min, (95°C 15 s, 60°C 30 s, 72°C 30s) for 40 cycles. The primer sequences (forward and reverse) are as follows: PTEN: TGGATTCGACTTAGACTTGACCT, GCGGTGTCATAATGTCTCTCAG; β-actin: GGCTGTATTCCCCTCCATCG, CCAGTTGGTAACAATGCCATGT. For miRNA detection, a total of 400 ng RNA was subjected to reverse transcription-PCR with Bulge-Loop™ miRNA qRT-PCR Primer Set (RiboBio, China) and CFX96 Touch™ Real-Time PCR Detection System (BioRad, USA). The following cycle parameters were used: 95°C 20 s, (95°C 10 s, 60°C 20 s, 72°C 10s) for 40 cycles. β-actin or U6 was used as internal control to equal cDNA content. The fold change of each gene expression was calculated using the 2^−ΔΔCT method.

Bei Y., Song Y., Wang F., Dimitrova-Shumkovska J., Xiang Y., Zhao Y., Liu J., Xiao J, & Yang C. (2015). miR-382 targeting PTEN-Akt axis promotes liver regeneration. Oncotarget, 7(2), 1584-1597.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis of Mouse Hippocampus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from mouse hippocampal tissue using Trizol reagent (Invitrogen, CA, USA).⁵² Reverse transcription of 1 μg of total RNA was performed with oligonucleotide deoxythymidine primers using Improm-II TM Reverse Transcription System (Promega, WI, USA). The resulting cDNA was used as template for the amplification of target gene transcripts by real-time PCR. Quantitative real-time PCR (qPCR) was performed on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories, CA, USA) using SensiFASTTM SYBR No-ROX mix (Bioline). Quantitative real-time PCR (qPCR) was performed on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories, CA, USA). GAPDH was used to normalize the threshold cycle⁵⁷ values, and gene expression was quantified by the relative quantitation method (

2^{- Δ Δ C t}

).²⁷ (link)

Seo J.Y., Jo H.R., Lee S.H., Kim D.G., Lee H., Kim Y.L., Choi Y.I., Jung S.J, & Son H. (2023). TRPC4 deletion elicits behavioral defects in sociability by dysregulating expression of microRNA-138-2. iScience, 27(1), 108617.

+ Open protocol

+ Expand

Quantifying MSC Gene Expression in 3D Hydrogels

Check if the same lab product or an alternative is used in the 5 most similar protocols

After a fourteen-day MSC-encapsulated hydrogel in culture, samples were homogenized in 1 mL of TRIzol reagent using TissueLyser (Qiagen). Total RNA was extracted from MSCs using TRIzol reagent (Invitrogen) and NucleoSpin RNA kit (Macherey-Nagel) following the manufacturer’s protocol. RNA was reverse transcribed by RevertAid™ First Strand cDNA Synthesis Kit (Thermo Scientific) in a 20 μL reaction mixture using CFX96 Touch Real-Time PCR Detection System (Biorad, United States). The cDNA products were amplified using Maxima SYBR Green qPCR Master Mix (Thermo Scientific) and following SOX9 primer (Hs.PT.58.38984663). PCR reactions were conducted in triplicate using CFX96 Touch Real-Time PCR Detection System (Biorad, United States of America). The results were analyzed using the 2^−ΔΔCT method and presented as fold change (relative gene expression) normalized to the GAPDH gene (Hs.PT.39a.22214836).

Mohd Isa I.L., Zulkiflee I., Ogaili R.H., Mohd Yusoff N.H., Sahruddin N.N., Sapri S.R., Mohd Ramli E.S., Fauzi M.B, & Mokhtar S.A. (2023). Three-dimensional hydrogel with human Wharton jelly-derived mesenchymal stem cells towards nucleus pulposus niche. Frontiers in Bioengineering and Biotechnology, 11, 1296531.

+ Open protocol

+ Expand

Gene Expression Analysis by qPCR and miRNA Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

For gene expression analysis, RNA was treated with TURBO DNA-free Kit (Invitrogen) and cDNA was synthesized using Random Hexamers (Invitrogen), dNTPs (Bioline) and SuperScript III Reverse Transcriptase (Invitrogen). qPCR was carried out in CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA) using cDNA, primers and iQ SYBR Green Supermix (Bio-Rad). Oligonucleotides used for qPCR experiments are shown in Supplementary Table 1.
miR-146b-5p, miR-342–3p, miR-124–3p, and let-7i-5p expression was evaluated using TaqMan miRNA assays (Applied Biosystems). In brief, cDNA was synthesized using 30 ng of RNA as a template, gene-specific stem-loop Reverse Transcription primer, and the TaqMan miRNA reverse transcription kit (Applied Biosystems). qPCR was carried out in CFX96 Touch Real-Time PCR Detection System (Bio-Rad) using cDNA, TaqMan probe and SsoAdvanced Universal Probes Supermix (Bio-Rad). Small nuclear RNA U6 was used as reference gene. All runs were performed in duplicate. Relative expression levels from eight independent experiments were calculated using the quantification cycle (C_q) method, according to MIQE guidelines^{24 (link)}.

Brás J.P., Bravo J., Freitas J., Barbosa M.A., Santos S.G., Summavielle T, & Almeida M.I. (2020). TNF-alpha-induced microglia activation requires miR-342: impact on NF-kB signaling and neurotoxicity. Cell Death & Disease, 11(6), 415.

+ Open protocol

+ Expand

Real-Time PCR Quantification with CFX96 System

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CFX96 Touch Real-Time PCR Detection System—Bio-Rad CA was used for real-time PCR [24 (link)]. To prepare the reaction mix (10 μL), 5 μL of 2× reaction buffer, 0.1 μL of sense and anti-sense primer, 1 μL of cDNA, and 3.8 μL of sterile water were added. Initial denaturation was carried out at 95 °C for 3 min, followed by 40 cycles of PCR, denaturation at 95 °C for 10 s, annealing at 60 °C for 20 s, and extension at 72 °C for 20 s. With no template control (NTC), all reactions were performed in triplicate. The analysis was performed with the Bio-Rad CFX96 Touch Real-Time PCR Detection System and β-actin as a control (Table 1).

Venkatesan A., Roy A., Kulandaivel S., Natesan V, & Kim S.J. (2022). p-Coumaric Acid Nanoparticles Ameliorate Diabetic Nephropathy via Regulating mRNA Expression of KIM-1 and GLUT-2 in Streptozotocin-Induced Diabetic Rats. Metabolites, 12(12), 1166.

+ Open protocol

+ Expand

Quantification of exosomal miR-425-3p and AKT1 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Exosomal RNAs were isolated using a miRNeasy Serum/Plasma Kit (Qiagen, Hilden, Germany) and cDNA was synthesized using a miScript II Reverse Transcription Kit (Qiagen). Quantification of miRNAs was performed using a miScript SYBR Green PCR Kit (Qiagen) on the Bio-Rad CFX96 Touch^TM Real-Time PCR Detection System (Bio-Rad, Hercules, CA). Quantitative real-time PCR analyses of hsa-miR-425-3p and AKT1 mRNA expression were conducted as previously reported.3 (link) The absolute concentrations of hsa-miR-425-3p in exosomes were calculated from calibration curves developed with synthetic miRNA oligonucleotides and normalized the miRNA concentration to the exosomal protein content. U6 snRNA was used as an endogenous control to normalize miR-425-3p expression in cells, and β-actin was used as the endogenous control to normalize AKT1 expression.

Ma Y., Yuwen D., Chen J., Zheng B., Gao J., Fan M., Xue W., Wang Y., Li W., Shu Y., Xu Q, & Shen Y. (2019). Exosomal Transfer Of Cisplatin-Induced miR-425-3p Confers Cisplatin Resistance In NSCLC Through Activating Autophagy. International Journal of Nanomedicine, 14, 8121-8132.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!