Miscript 2 rt kit

Manufactured by Takara Bio

Sourced in China

The MiScript II RT Kit is a reverse transcription kit designed for the detection and quantification of microRNA (miRNA) expression. The kit efficiently converts mature miRNAs into complementary DNA (cDNA) for use in real-time quantitative PCR (RT-qPCR) analysis.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

MiScript RT Kit (14 citations) RT kits (2 citations)

10 protocols using miscript 2 rt kit

Analysis of ErbB3 and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of tissues and cells was isolated by TRIzol reagent (Invitrogen) following the manufacturer’s protocol. The mRNA expression levels were detected by qRT-PCR. The complementary DNA (cDNA) was obtained by reverse transcription utilizing the miScript II RT Kit (TAKARA, Kusatsu, Japan). The SYBR Green PCR Kits (TAKARA) were employed to conduct quantitative PCR. Primers were synthetized by RiboBio (Guangzhou, P.R. China). The following primers were used: ErbB3, 5′-GGTGATGGGGAACCTTGAGAT-3′ (forward) and 5′-CTGTCACTTCTCGAATCCACTG-3′ (reverse); glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5′-ACAACTTTGGTATCGTGGAAGG-3′ (forward) and 5′-GCCATCACGCCACAGTTTC-3′ (reverse). Each sample was assessed in triplicate. The expression levels of mRNAs were normalized to levels of GAPDH, which acted as a housekeeping gene.
For the detection of human miRNAs, the TaqMan MicroRNA Reverse Transcription Kit and TaqMan miRNA assay (Qiagen, Hilden, Germany) were used to perform reverse transcription and PCR according to the manufacturer’s instructions. Reverse transcription was performed using the miScript II RT Kit (TAKARA), which was followed by qRT-PCR utilizing the miScript SYBR Green PCR Kit (TAKARA) and hsa-miR-125a-5p and hsa-miR-4319 specific primers that were purchased from RiboBio. The levels of miRNAs were normalized to levels of U6 small nuclear RNA (snRNA).

Li G., Zhang W., Gong L, & Huang X. (2019). MicroRNA 125a-5p Inhibits Cell Proliferation and Induces Apoptosis in Hepatitis B Virus-Related Hepatocellular Carcinoma by Downregulation of ErbB3. Oncology Research, 27(4), 449-458.

+ Open protocol

+ Expand

Tissue Graft RNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Graft samples (6um) were stained with hematoxylin and eosin (HE). TRIzol (Sigma) reagent was used to extract total RNA from graft samples. For the analysis, 2 μg total RNA was reversely transcribed into cDNA with the miScript II RT kit (TaKaRa Biotechnology Co., Ltd., Dalian, China), and qPCR was performed with TB Green® Premix Ex Taq™(RR820A, Takara, Japan) on the BioRad real-time PCR instrument. The primer sequences are shown in the Table1.

Wu W., Wang M., Li C., Zhu Z., Zhang Y., Wu D., Ou Z, & Liu Z. (2022). LncRNA Snhg1 Plays an Important Role via Sequestering rno-miR-139-5p to Function as a ceRNA in Acute Rejection After Rat Liver Transplantation Based on the Bioinformatics Analysis. Frontiers in Genetics, 13, 827193.

+ Open protocol

+ Expand

Total RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs from tissues and tissues were extracted with TRIzol (Sigma) reagent according to the protocols provided by corporation. Reversely transcription and qPCR were performed using miScript II RT kit (TaKaRa Biotechnology Co., Ltd., Dalian, China) and SYBR Premix Ex TaqTM II (Takara, Japan) on the ABI PRISM 7500 real-time PCR System. The primer sequences used were showed in Table 1.

Wu W., Guo L., Liang Z., Liu Y, & Yao Z. (2020). Lnc-SNHG16/miR-128 axis modulates malignant phenotype through WNT/β-catenin pathway in cervical cancer cells. Journal of Cancer, 11(8), 2201-2212.

+ Open protocol

+ Expand

Quantitative Analysis of RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells or tissues with the help of Trizol reagent (Invitrogen) according to the manufacturer’s protocol. To detect the expression levels of MIR155HG and BRD4, cDNA was reversed from 2 μg of total RNA using a PrimeScript RT Master Mix Kit (Takara, Shiga, Japan). For detecting miR-218-5p level, cDNA was synthesized using miScript II RT kit (Takara). Then, quantitative PCR was performed using SYBR Green PCR Master Mix kit (Takara) on a PRISM® 7300 system (Applied Biosystems, Foster City, CA, U.S.A.). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6 was used as an internal inference and the relative expression level was evaluated by 2^−ΔΔCt method. The special primers were listed: MIR155HG, forward 5′-CCCAAATCTAGGTTCAAGTTC-3′, reverse 5′-ATCTAAGCCTCACAACAAC-3′; GAPDH, forward 5′-AGGTGAAGGTCGGAGTCAACG-3′, reverse 5′-AGGGGTCATTGATGGCAACA-3; BRD4, forward 5′-CCCCTCGTGGTGGTGAAG-3′, reverse 5′-GCTCGCTGCGGATGATG-3′; miR-218-5p, forward 5′-AACACGAACTAGATTGGTACA-3′, reverse 5′-AGTCTCAGGGTCCGAGGTATTC-3′; U6, forward 5′-GCTTCGGCAGCACATATACTAAAAT-3′, reverse 5′-CGCTTCACGAATTTGCGTGTCAT-3′.

Song J., Wang Q, & Zong L. (2020). LncRNA MIR155HG contributes to smoke-related chronic obstructive pulmonary disease by targeting miR-128-5p/BRD4 axis. Bioscience Reports, 40(3), BSR20192567.

+ Open protocol

+ Expand

Quantification of Gene Expression by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The TRIzol Reagent (Invitrogen) was used for extract total RNA from tissues and cells. RNA was reversely transcribed into cDNA using a miScript II RT kit (TaKaRa, Biotechnology Ltd., Dalian, China) and then the real-time qPCR was performed using a Premix Ex TaqTM II (TaKaRa) on an ABI PRISM 7500 real-time PCR System. Relative gene expression was determined by the 2^-ΔΔCt method. The primers are listed in Table 1, in which U6 and GAPDH were set as the internal references for miRNA and mRNAs, respectively.

Table 1

Primer sequences for RT-qPCR

Gene	Primer sequence (5′-3′)
miR-545	F: CGACAAGGGTCAGCAAACATT
miR-545	R: GCAGGGTCCGAGGTATTC
Bax	F: TCAGGATGCGTCCACCAAGAAG
Bax	R: TGTGTCCACGGCGGCAATCATC
Bcl-2	F: ATCGCCCTGTGGAGAACTACTGAGT
Bcl-2	R: GCCAGGAGAAATCAAACAGAGGC
KDM4B	F: GCCGAGAGGAAGTTCAACGCAG
KDM4B	R: TGCCTCCTTCTCAGAGTGTGTAGG
PLK1	F: GCACAGTGTCAATGCCTCCAAG
PLK1	R: GCCGTACTTGTCCGAATAGTCC
U6	F: CTCGCTTCGGCAGCACA
U6	R: AACGCTTCACGCATTTGC
GAPDH	F: GTCTCCTCTGACTTCAACAGCG
GAPDH	R: ACCACCCTGTTGCTGTAGCCAA

Note: RT-qPCR reverse transcription quantitative polymerase chain reaction, Bcl-2 B-cell lymphoma-2, Bax Bcl-2-associated X, KDM4B Lysine (K)-specific demethylase 4B, PLK1 Polo-like kinase 1, GAPDH glyceraldehyde-3-phosphate dehydrogenase, F forward, R reverse

Zhang H., Zhang K., Xu Z., Chen Z., Wang Q., Wang C, & Cui J. (2021). MicroRNA-545 suppresses progression of ovarian cancer through mediating PLK1 expression by a direct binding and an indirect regulation involving KDM4B-mediated demethylation. BMC Cancer, 21, 163.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the tumor cells and tissues using TRIzol (Sigma) reagent according to a previously described protocol 29 (link). A NanoDrop 2000 (Thermo, USA) was used to quantify the concentrations of the RNA. Total RNA was then reverse transcribed to complementary DNA (cDNA) using a miScript II RT kit (TaKaRa Biotechnology Co., Ltd., Dalian, China), and qPCR was performed using TB Green® Premix Ex Taq™ (RR820A, Takara, Japan) and a Bio-Rad real-time PCR instrument.
The primer sequences are listed in Supplementary Table 1.

Wu W., Li Q., Zhu Z., Li C., Lu P., Zhou X., Huang Y., Liu Y., Wang M, & Gong J. (2022). HTR1D functions as a key target of HOXA10-AS/miR-340-3p axis to promote the malignant outcome of pancreatic cancer via PI3K-AKT signaling pathway. International Journal of Biological Sciences, 18(9), 3777-3794.

+ Open protocol

+ Expand

Quantification of miR-5195-3p and EIF4A2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tissues or cells using TRIzol reagent (Takara) and cDNA was synthesized using a miScript II RT Kit or PrimeScript cDNA Synthesis Kit (Takara). Quantitative real-time PCR was performed using a miScript SYBR Green PCR Kit (Qiagen) or a LightCycler 480 SYBR Green I Master PCR Kit (Roche) for miR-5195-3p or EIF4A2 detection. The primer sequences synthesized by Sangon Biotech (Shanghai) were: miR-5195-3p, forward: 5′-TAGCAGACTCTTATGATG-3′ and reverse: 5′-TGGTGGAGTCGTCGTG-3′; U6, forward: 5′-CTCGCTTCGGCAGCACA-3′ and reverse: 5′-AACGCTTCACGAATTTGCGT-3′; EIF4A2 forward: 5′-ATGTTCGCTTCGAGACGTGC-3′; and reverse: 5′-TTTCACTAAAGGCAGAGAGTCAG-3′; and GAPDH forward: 5′-ATCGTCCACCGCAAATGCTTCTA-3′; and reverse: 5′-AGCCATGCCAATCTCATCTTGTT-3′. The relative expressions of miR-5195-3p or EIF4A2 were respectively normalized to the expression of U6 or GAPDH.

Liu M., Gong C., Xu R., Chen Y, & Wang X. (2019). MicroRNA-5195-3p enhances the chemosensitivity of triple-negative breast cancer to paclitaxel by downregulating EIF4A2. Cellular & Molecular Biology Letters, 24, 47.

+ Open protocol

+ Expand

RNA Quantification via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cDNA was extracted by using PrimeScript^TM RT reagent kit (TaKaRa, Wuhan, China) or miScript II RT Kit (TaKaRa). qPCR was performed using a SYBR premix Ex TaqII kit (TaKaRa) on 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The primers used for RT-qPCR were shown in Table 2. GAPDH and U6 were used as the internal controls.

Meng X., Tian H., Guo W, & Wang Z. (2021). circ_0082375 promotes the progression of glioma by regulating Wnt7B. Translational Neuroscience, 12(1), 456-468.

+ Open protocol

+ Expand

Rat RNA Extraction and RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from cells and the nasal mucosa of rats were extracted using TRIzol (Thermo Fisher, USA) according to the manufacturer's instructions. The RNA was then reverse-transcribed into complementary DNA (cDNA) using the miScript II RT Kit (Takara, Japan). RT-qPCR was performed using the miScript SYBR Green PCR kit (Novoprotein Scientific, China) with the QuantStudio7 Flex PCR system for amplification. The experiment was repeated in triplicate, and the primer sequences are listed in Additional file 1: Fig. S4. Gene expression levels were measured by the 2^−ΔΔCT method.

Dai L., Liu B., Lin J., Jiang Y., Li Y., Yao Z., Shen S., Jiang Y., Duan Y, & Li J. (2024). Long-acting anti-inflammatory injectable DEX-Gel with sustained release and self-healing properties regulates TH1/TH2 immune balance for minimally invasive treatment of allergic rhinitis. Journal of Nanobiotechnology, 22, 51.

+ Open protocol

+ Expand

Quantifying miR-448 and ZEB1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was separated by TRIzol reagent (Takara), and cDNA was synthesized with miScript II RT Kit. The miScript SYBR Green PCR Kit (Qiagen) was applied in real-time quantitative PCR. PCR primers were designed and synthesized by Make Research Easy Co., Ltd. The following primers were used: miR-448, F: 5′-TTATTGCGATGTGTTCCTTATG-3′ and R: 5′-ATGCATGCCACGGGCATATACACT-3′; U6, F: 5′-CTCGCTTCGGCAGCACA-3′ and R: 5′-AACGCTTCACGAATTTGCGT-3′; ZEB1, F: 5′-GCCAATAAGCAAACGATTCTG-3′ and R: 5′-TTTGGCTGGATCACTTTCAAG-3′; GAPDH: F: 5′-CAAGGTCATCCATGACAACTTTG-3′ and R: 5′-GTCCACCACCCTGTTGCTGTAG-3′. U6 was used as an internal reference for miR-448, GAPDH was used as an internal reference for ZEB1, and the 2^−△△Ct method was employed for quantitative analysis. All reactions were performed with three negative controls with multiple holes and no template.

Zhou Y., Sun L., Zhang Y, & Chen K. (2022). Micro ribonucleic acid-448 regulates zinc finger e-box binding homeobox 1 to inhibit the growth of breast cancer cells and increase their sensitivity to chemotherapy. Clinics, 77, 100089.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!