Puromycin

A375 cells growing in a 35-mm plate were transfected after reaching 80% of the confluence with a mixture of two plasmids used in the CRISPR/Cas9(D10A) system. The double Nickase Plasmid system from Santa Cruz Biotechnology Inc. (Heidelberg, Germany) comprises coding sequences for nickase Cas9 (D10A), two different guideRNA (gRNA) sequences designed specifically for the gelsolin gene (sc-401005-NIC), and two cell selection methods, i.e., puromycin resistance and green fluorescent protein (GFP). The gRNAs’ sequences for GSN are as follows: 5′ccgggccgtgcagcaccgtg3′ and 5′atccagctgcacggtaaaga3′. For cell transfection, 2 mg/mL polyethyleneimine solution (Sigma-Aldrich, Poznań, Poland) was used in a ratio of 1:2.175 for 4 µg of DNA solution. Then, 24 h after transfection, the cells were seeded onto 15 cm plates. Cells were incubated with puromycin (Santa Cruz Biotechnology Inc., Heidelberg, Germany) at a concentration of 1 µg/mL. After forming the clones, they were then transferred individually using glass cylinders into a 24-well plate. The clones’ cultivation was continued with the usage of a selective antibiotic at a concentration of 0.5 µg/mL. After the stable lines were derived, they were verified for their correctness using immunocytochemistry, Western blot, and gDNA analyses to confirm the deprivation of GSN.

For gene editing at the TH locus, a Neon electroporation system was used (ThermoFisher, cat# MPK5000), using methodology adapted for gene editing hiPSC (Buchrieser et al., 2017 (link); Flynn et al., 2015 (link)). 3 × 10⁶ hiPSCs of each cell line were transfected by electroporation (1250 V, 20 ms pulse width, 1pulse) in a 100µL tip with 15 µg total DNA (3.11 µg sgRNA plasmid and 11.35 Donor plasmid). All plasmids used for electroporation were prepared using an endotoxin free MidiPrep Kit (ThermoFisher, cat# K210004). After electroporation, the cells were plated at high density (4 × 10⁵ cells/cm²) in StemMACS medium without Pen/Strep containing 10 µM Rock-Inhibitor (Miltenyi, cat# 130–104–169). 24 h after electroporation Puromycin (SantaCruz Biotechnology, cat# sc-108071A) selection was started with 0.5 µg/ml for 48 h. After another 24 h without Puromycin cells were replated onto MEF cells for clonal selection (see supplementary information) and some were lysed for gDNA extraction for HDR screen.

An improved variant of GFP, mGFP, was used tagged to the open reading frame of MFN1 (RC207184L4V, Origene), MFN2 (RC202218L4V, Origene) or control (PS100071V, Origene) in a lentiviral particle plasmid. The stable over-expression cells were generated according to the product manual. Briefly, 1 × 10⁵ SNB-19 cells were seeded in each well of a 6-well plate and incubated overnight at 37°C. Then, cells were treated with 5 μg/ml polybrene (Santa Cruz Biotechnology, Inc.) and infected with lentiviral particles at MOI = 5. After overnight incubation with the virus, cells were incubated in fresh medium for another 24 h. The stable over-expression cells were selected by 2 μg/ml puromycin medium treatment for 3 days and kept in the 0.5 μg/ml puromycin (Santa Cruz Biotechnology, Inc.) medium for three passages before the test.

CTSB –/– cell lines were generated from H4 cells and H4 APP 751 cells using CRISPR/Cas9 KO and HDR Plasmid (Santa Cruz Biotechnology) according to the protocol of the supplier. Empty CRISPR/Cas9 plasmids (Santa Cruz Biotechnology) were used as control. For generation of single-cell colonies, Puromycin (Santa Cruz Biotechnology) resistant clones were selected by limiting dilution at <0.2 cells/well and maintained in the presence of 2 μg/ml Puromycin. Five clones of H4 and two clones of H4 APP 751 cells were identified having a bi-allelic knockout for CTSB by western blot analysis.

K562 (human erythroleukemia) cell line (American Type Culture Collection, Rockville, MD, USA) was grown between 2 × 10⁵ and 1.5 × 10⁶ cells/mL in Iscove’s Modified Dulbecco’s Medium (IMDM) glutamax (ThermoFisher Scientific, Illkirch, France) supplemented with FBS 10% and Gibco™ Antibiotic-Antimycotic at 37 °C with humid 5% CO₂ atmosphere. Cells were counted by trypan blue counting in a Malassez cell or CASY cell counter (OMNI life science, Bremen, Germany) and used for less than 20 passages.
During the exponential growth phase, 10⁶ K562 cells were co-transfected by electroporation using the Amaxa^® Cell Line Nucleofector^® kit V (Lonza, Basel, Switzerland) with 1 µg human Stomatin Homology-Directed DNA Repair (HDR) plasmids containing a puromycin resistance gene and 3 µg of human Stomatin CRISPR/Cas9 KO plasmids and 3 µg of human Stomatin CRISPR/Cas9 KO plasmids (Santa Cruz Biotechnology, Dallas, TX, USA). Immediately after the transfection, cells were transferred into 2 mL of culture medium to which 5 µg/mL of puromycin (Santa Cruz Biotechnology, Dallas, TX, USA) were added 24 h post-transfection. The expression of both plasmids was stabilized for 3 weeks by keeping puromycin in the culture medium. puromycin-resistant cells were then subjected to a limiting dilution cloning in 96-well microplates before expanding for flow cytometry analysis of several clones.